ExTraMapper

ExTraMapper is a tool to find Exon and Transcript-level Mappings of a given pair of orthologous genes between two organisms using sequence conservation. The figure below shows the overall schematic description of ExTraMapper mapping the homologous transcript and exon-pairs between human and mouse genome.

Steps to run ExtraMapper (For python version 3 or later usage)

Step 1: Prepare the input files

ExTraMapper requires a set of preprocessed files to find the conservation scores. Examples to create these files are provided within the following folders

1. Human-Mouse-Preprocessed-Data

   and

2. Human-Rhesus_macaque-Preprocessed-Data

Steps to generate the input files

The users should run the extMpreprocess to generate the inputfiles within the above Preprocessed-Data folders. All the input files will be generated under preprocess/data folder. All the required executables and scripts are provided here. The extMpreprocess has 7 individual steps and should be run in the following manner

• For help, type
  

  ```bash ./extMpreprocess help

  This script will download and preprocess the dataset required for exon-pair and transcript pair finding by ExTraMapper. Type ./extMpreprocess to execute the script. Type ./extMpreprocess example to print a example config.conf file.

  This script will run seven (7) sequential steps to create the inputs for ExTraMapper program. Users can provide step numbers (1-7) or all in the arugemt of this script. Short description of the individual scripts: Step 1: Download per organism specific files e.g. reference genomes, gene annotation files. Step 2: Will create genomedata archives with the genomes of org1 and org2 (Make sure to install genomedata package). Step 3: Pickle files for each homologous gene pair will be created. Step 4: Perform coordinate liftOver of exons with multiple mappings (This step requires bedtools and liftOver executables). Step 5-7: postprocessing the liftOver files.

  example:

  ./extMpreprocess config.human-mouse.conf all ```
  
  

Step 2: Set the following path

bash export EXTRAMAPPER_DIR=/path/to/this/folder

Step 3: Run ExTraMapper individually

```bash $ python ExTraMapper.py -h usage: ExTraMapper.py [-h] -m MAPPING -o1 ORG1 -o2 ORG2 -p ORTHOLOG

Check the help flag

optional arguments: -h, --help show this help message and exit -m MAPPING ExTraMapper Exon threshold value [e.g. 1] -o1 ORG1 First organism name [e.g. human] -o2 ORG2 Second organism name [e.g. mouse] -p ORTHOLOG Orthologous gene pair [e.g. ENSG00000141510-ENSMUSG00000059552 OR all] ```

Example run of ExTraMapper.py using orthologous gene pair ENSG00000141510-ENSMUSG00000059552

```bash $ python ExTraMapper.py -m 1 -o1 human -o2 mouse -p ENSG00000141510-ENSMUSG00000059552

Finding exon mappings for gene pair number 0 ENSG00000141510-ENSMUSG00000059552

---

Gene pair ID: ENSG00000141510-ENSMUSG00000059552

Information about each gene. Last two numbers are no of transcripts and exons ENSG00000141510 chr17 7661779 7687538 - ENSG00000141510 TP53 proteincoding 27 49 gene ENSMUSG00000059552 chr11 69580359 69591873 + ENSMUSG00000059552 Trp53 proteincoding 6 24 gene

Number of exons before and after duplicate removal according to coordinates Org1 49 40 Org2 24 20

---

---

GCGCTGGGGACCTGTCCCTAGGGGGCAGATGAGACACTGATGGGCGTACTTAGAGATTTGCCATGAAGTGGGTTTGAAGAATGGAGCTGTGTGTGAAAT Exon file type summaries for the first gene from: ENSG00000141510-ENSMUSG00000059552 0 exons with: No file exists 22 exons with: Only Mapped 0 exons with: Only nonintersecting 11 exons with: Only unmapped 15 exons with: Mapped and unmapped 0 exons with: Mapped and nonintersecting 1 exons with: Nonintersecting and unmapped 0 exons with: All three files Exon file type summaries for the second gene from: ENSG00000141510-ENSMUSG00000059552 0 exons with: No file exists 14 exons with: Only Mapped 0 exons with: Only nonintersecting 3 exons with: Only unmapped 7 exons with: Mapped and unmapped 0 exons with: Mapped and nonintersecting 0 exons with: Nonintersecting and unmapped 0 exons with: All three files Writing exon-level similarity scores into file: /path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/exonLevelSimilarities-1.0.txt

Writing exon classes into file: /path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/exonClasses-1.0.txt For org1: Mapped exons= 17, Unmapped exons= 21, Nonintersecting exons= 1, OTHER= 10 For org2: Mapped exons= 13, Unmapped exons= 7, Nonintersecting exons= 0, OTHER= 4

---

---

Writing exon-level mappings into file: /path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/exonLevelMappings-1.0.txt Writing trascript-level similarity scores into file: /path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/transcriptLevelSimilarities-1.0.txt Writing transcript-level mappings into file: /path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/transcriptLevelMappings-1.0.txt

Condition counter from the greedy transcript mapping stage: 5 pairs with Condition1: Unique winner pair 0 pairs with Condition2: Tie in one score, not in the other 0 pairs with Condition3: Tie in both scores but coding exon length diff breaks the tie 0 pairs with Condition4: Tie in both scores and coding exon length diff but overall exon length breaks the tie 1 pairs with Condition5: Tie in all the above but coding length (bp) diff breaks the tie 0 pairs with Condition6: Tie in all the above, just give up and report all

Writing UCSC browser bed output for org1 into file: /path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/org1-ucsc-1.0.bed Writing UCSC browser bed output for org2 into file: /path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/org2-ucsc-1.0.bed

........ ExTraMapper ran successfully for 1 gene pairs between: human and mouse

---

$ tree ./output

./output -- human-mouse -- ENSG00000141510-ENSMUSG00000059552 |-- exonClasses-1.0.txt |-- exonLevelMappings-1.0.txt |-- exonLevelSimilarities-1.0.txt |-- org1-ucsc-1.0.bed |-- org2-ucsc-1.0.bed |-- transcriptLevelMappings-1.0.txt -- transcriptLevelSimilarities-1.0.txt ``

Note: The exonLevelMappings-1.0.txt & transcriptLevelMappings-1.0.txt file contains the mapped exon and transcript pairs from ENSG00000141510-ENSMUSG00000059552 orthologous gene-pair.

OR

Step 3: Run ExTraMapper for all the gene pairs

bash $ python ExTraMapper.py -h usage: ExTraMapper.py [-h] -m MAPPING -o1 ORG1 -o2 ORG2 -p all

Summarise the ExTraMapper results

Run extMsummarise script to generate a concatenated file will all the results. Run the script in the follwoing manner ```bash $ ./extMsummarise help Type ./extMsummarise preprocessfolder : Path to the preprocess folder generated by the extMpreproces script extramapperfolder : Path to the output folder generated by ExTraMapper program orthologousgenepairlist : A list of orthologous gene-pairs org1name : org1 name e.g. human org2name : org2 name e.g. mouse outputprefix : output file prefix

example : ./extMsummarise ./preprocess ./output gene-pair.list human mouse extramapper-result ```

Prepocessed Results

Check the Result/Exon-Pairs and Result/Transcript-Pairs to download the precomputed ExTraMapper result for human-mouse and human-rhesus orthologous exon and transcript pairs.

Refer the work

ExTraMapper: Exon- and Transcript-level mappings for orthologous gene pairs.

Chakraborty A, Ay F, Davuluri RV. ExTraMapper: Exon- and Transcript-level mappings for orthologous gene pairs. Bioinformatics. 2021 May 20:btab393. doi: 10.1093/bioinformatics/btab393. Epub ahead of print. PMID: 34014317.

The data shown in the above paper was performed using Human & Mouse ENSMBL release 81 with python 2.7 code. The current update is with ENSMBL release 102 and python 3 or later version. To see the older code and data please change the Branch to ExTraMapper-python2v from master

Check the webserver for a nice vizualization

https://ay-lab-tools.lji.org/extramapper/index.html