2022_periscope
This repository contains all supporting analyses and files for Ramezani, Weisbart, Bauman, and Singh, et al. "A genome-wide atlas of human cell morphology".
Science Score: 57.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
○CITATION.cff file
-
✓codemeta.json file
Found codemeta.json file -
✓.zenodo.json file
Found .zenodo.json file -
✓DOI references
Found 3 DOI reference(s) in README -
✓Academic publication links
Links to: biorxiv.org -
○Academic email domains
-
✓Institutional organization owner
Organization broadinstitute has institutional domain (www.broadinstitute.org) -
○JOSS paper metadata
-
○Scientific vocabulary similarity
Low similarity (11.4%) to scientific vocabulary
Repository
This repository contains all supporting analyses and files for Ramezani, Weisbart, Bauman, and Singh, et al. "A genome-wide atlas of human cell morphology".
Basic Info
- Host: GitHub
- Owner: broadinstitute
- License: bsd-3-clause
- Language: Jupyter Notebook
- Default Branch: main
- Homepage: https://doi.org/10.1038/s41592-024-02537-7
- Size: 2.03 GB
Statistics
- Stars: 8
- Watchers: 9
- Forks: 0
- Open Issues: 1
- Releases: 0
Metadata Files
README.md
A genome-wide atlas of human cell morphology
This repository contains all supporting analyses and files for Ramezani, Weisbart, Bauman, and Singh, et al. "A genome-wide atlas of human cell morphology". It also includes download information for the images and profiles used in the analysis. It was published in Nature Methods in 2025. It is also available as a preprint on bioRxiv.
Authors
Meraj Ramezani, Erin Weisbart, Julia Bauman, Avtar Singh, John Yong, Maria Lozada, Gregory P. Way, Sanam L. Kavari, Celeste Diaz, Eddy Leardinin, Gunjan Jetley, Jenlu Pagnotta, Marzieh Haghighi, Thiago M. Batista, Joaqun Prez-Schindler, Melina Claussnitzer, Shantanu Singh, Beth A. Cimini, Paul C. Blainey, Anne E. Carpenter, Calvin H. Jan, James T. Neal *equal contribution co-senior authors
Abstract
A key challenge of the modern genomics era is developing data-driven representations of gene function. Here, we present the first unbiased morphology-based genome-wide perturbation atlas in human cells, containing three genome-scale genotype-phenotype maps comprising >20,000 single-gene CRISPR-Cas9-based knockout experiments in >30 million cells. Our optical pooled cell profiling approach (PERISCOPE) combines a de-stainable high-dimensional phenotyping panel (based on Cell Painting1,2) with optical sequencing of molecular barcodes and a scalable open-source analysis pipeline to facilitate massively parallel screening of pooled perturbation libraries. This approach provides high-dimensional phenotypic profiles of individual cells, while simultaneously enabling interrogation of subcellular processes. Our atlas reconstructs known pathways and protein-protein interaction networks, identifies culture media-specific responses to gene knockout, and clusters thousands of human genes by phenotypic similarity. Using this atlas, we identify the poorly-characterized disease-associated transmembrane protein TMEM251/LYSET as a Golgi-resident protein essential for mannose-6-phosphate-dependent trafficking of lysosomal enzymes, showing the power of these representations. In sum, our atlas and screening technology represent a rich and accessible resource for connecting genes to cellular functions at scale.
Computational environment
Python
We use conda to manage the computational environment. To install conda see instructions.
After installing conda, execute the following to install and navigate to the environment:
```bash
Install the conda environment
conda env create --force --file environment.yml
Activate the environment
conda activate periscope_2022 ```
Expected install time for the computational environment is less than 10 minutes.
Replicating our workflow
All of our data is publicly available so that our entire workflow can be replicated. However, many of the processing steps require significant computational resources and cannot be replicated on an average personal computer. To address this, we have provided many intermediate files. Input images, intermediate processed images, and the final images used for analysis are available as described in Downloading images. Input profiles, intermediate processed profiles, and the final profiles used for analysis are available as described in Downloading profiles.
Final profile aggregation, hit calling, and all biological discovery described in the paper are performed in Jupyter notebooks provided in this repository. Each folder in this repository contains the input files used, logical intermediates generated, and/or a README file describing how to download any that are too large for the repository.
We have described a minimal example you can use, where possible, to practice using our workflow. However, it is very important to understand that extracting meaningful biology is only possible at scale so any minimal examples are to be used for technical but not biological understanding.
Our workflow should be able to be replicated on any operating system that can run Python and install the dependencies described in our environment.yml and has been tested end-to-end on a Mac operating system and components have been tested on both Windows and Linux operating systems.
Downloading data
Cell Painting images and profiles are available at the Cell Painting Gallery on the Registry of Open Data on AWS (https://registry.opendata.aws/cellpainting-gallery/) under accession number cpg0021-periscope.
Detailed download and file organization information for the Cell Painting Gallery are available at https://github.com/broadinstitute/cellpainting-gallery.
A549 data is labeled as batch 20200805_A549_WG_Screen and may also be referred to as CP186 in some file names.
HeLa data is labeled as batch 20210422_HeLa_WG_Screen and may also be referred to as 20210422_6W_CP257 or CP257 in some file names.
DMEM and HPLM conditions were separated by plate. \
DMEM plates are CP257A,CP257B,CP257D,CP257F, and CP257H. \
HPLM_plates are CP257J,CP257K,CP257L, and CP257N. \
Downloading images
The image metadata will be automatically extracted from the images using the pipelines provided at https://github.com/broadinstitute/pooled-cell-painting-image-processing. An orientation to the images is as follows:
images
images contains the raw images as they come off the microscope.
The images can be downloaded using the command
bash
batch=20200805_A549_WG_Screen
plate=CP186A
session=20X_CP_CP186A
aws s3 cp \
--no-sign-request \
--recursive \
s3://cellpainting-gallery/cpg0021-periscope/broad/images/${batch}/images/${plate}/${session} .
Cell Painting
Within each plate folder, Cell Painting images are organized into a single folder labeled 20XCP${plate}. Each 6-well plate contains images from 1364 (for A549 screen) or 1332 (for HeLa screen) sites for each well. There is 1 .nd2 file per site with five fluorescent images (DAPI, GFP, A594, Cy5, 750) corresponding to the cell painting images. Sites have a 10% overlap.
Barcoding
Within each plate folder, barcoding images are organized into a folder per cycle for each of 12 cycles labeled 10X_c#-SBS-# where # is the cycle number. Each 6-well plate contains images from 320 (for A549 screen) or 316 (for HeLa screen) sites for each well. There is 1 .nd2 file per site with five fluorescent images (DAPI, Cy3, A594, Cy5, Cy7) corresponding to DNA and the four nucleotides read in SBS. Sites have a 10% overlap.
illum
illum contains whole plate illumination correction images.
The images can be downloaded using the command
bash
batch=20200805_A549_WG_Screen
plate=CP186A
aws s3 cp \
--no-sign-request \
--recursive \
s3://cellpainting-gallery/cpg0021-periscope/broad/images/${batch}/illum/${plate} .
images_aligned
images_aligned contains the whole-plate illumination corrected Barcoding images where channels are aligned within cycles.
Within the images_corrected folder, images are nested by arm (barcoding) and are saved in folders by plate-well.
The images can be downloaded using the command
bash
batch=20200805_A549_WG_Screen
plate=CP186A
aws s3 cp \
--no-sign-request \
--recursive \
s3://cellpainting-gallery/cpg0021-periscope/broad/images/${batch}/images_aligned/barcoding/ . \
--exclude "*" \
--include "${plate}*"
images_corrected
images_corrected contains the whole-plate illumination corrected Cell Painting images and the aligned Barcoding images that have undergone channel compensation and background removal.
Within the images_corrected folder, images are nested by arm (barcoding vs. painting) and are saved in folders by plate-well-site.
The images can be downloaded using the command
bash
batch=20200805_A549_WG_Screen
plate=CP186A
aws s3 cp \
--no-sign-request \
--recursive \
s3://cellpainting-gallery/cpg0021-periscope/broad/images/${batch}/images_corrected/ . \
--exclude "*" \
--include "*${plate}*"
images_corrected_cropped
images_corrected_cropped contains stitched and cropped pseudo-site images where the pseudo-site corresponds between Cell Painting and Barcoding images.
These are the images used in the final analysis pipeline.
Within the images_corrected folder, images are saved in folders by plate_well.
The images can be downloaded using the command
bash
batch=20200805_A549_WG_Screen
plate=CP186A
aws s3 cp \
--no-sign-request \
--recursive \
s3://cellpainting-gallery/cpg0021-periscope/broad/images/${batch}/images_corrected_cropped/ . \
--exclude "*" \
--include "${plate}*"
Downloading profiles
Image-based profiles were generated using the Pooled Cell Painting Profiling Template and Profiling Recipe. Configuration for A549 profile generation is found in this repository. Configuration for HeLa profile generation is found in this repository.
Find listed below the filenames for all of the profiles generated.
| Dataset | AggregateMethod | AggregateLevel | AggregateGroup | Normalize | FeatureSelect | SecondAggregateMethod | SecondAggregateLevel | SecondNormalize | ThirdAggregateMethod | ThirdAggregateLevel | FileName | |----|----|----|----|----|----|----|----|----|----|----|----| | A549 | Median | Gene | Plate | N | N | N | N | N | N | N | 20200805A549WGScreengeneALLBATCHES{PLATE}ALLWELLS.csv.gz | | A549 | Median | Gene | Plate | Standardize | N | N | N | N | N | N | 20200805A549WGScreengenenormalizedALLBATCHES{PLATE}ALLWELLS.csv.gz | | A549 | Median | Guide | Plate | N | N | N | N | N | N | N | 20200805A549WGScreenguideALLBATCHES{PLATE}ALLWELLS.csv.gz | | A549 | Median | Guide | Plate | Standardize | N | N | N | N | N | N | 20200805A549WGScreenguidenormalizedALLBATCHES{PLATE}ALLWELLS.csv.gz | | A549 | Median | Guide | Plate | Standardize | N | Median | Y | N | N | N | 20200805A549WGScreenguidenormalizedmedianmergedALLBATCHESALLWELLS.csv.gz | | HeLa | Median | Guide | Plate | N | N | N | N | N | N | N | 202104226WCP257guideALLBATCHES{PLATE}ALLWELLS.csv | | HeLa | Median | Gene | Plate | N | N | N | N | N | N | N | 202104226WCP257geneALLBATCHES{PLATE}ALLWELLS.csv | | HeLa | Median | Gene | Plate | Standardize | N | N | N | N | N | N | 202104226WCP257genenormalizedALLBATCHES{PLATE}ALLWELLS.csv | | HeLa | Median | Guide | Plate | Standardize | N | N | N | N | N | N | 202104226WCP257guidenormalizedALLBATCHES{PLATE}ALLWELLS.csv | | HeLa | Median | Guide | Plate | Standardize | N | Median | DMEM | N | N | N | 202104226WCP257guidenormalizedmedianmergedALLBATCHESDMEMALLWELLS.csv | | HeLa | Median | Guide | Plate | Standardize | N | Median | HPLM | N | N | N | 202104226WCP257guidenormalizedmedianmergedALLBATCHESHPLM_ALLWELLS.csv |
Download profiles using the following command
Note that filehead is the filename before the first ___.
bash
dataset=HeLa
filehead=20200805_A549_WG_Screen_gene_ALLBATCHES
aws s3 cp \
--no-sign-request \
s3://cellpainting-gallery/cpg0021-periscope/broad/workspace/profiles/${dataset} . \
--exclude "*" \
--include "${filehead}*"
single cell profiles
The datasets also have the additional resource of single cell profiles, available on a per-plate or per-guide basis.
Download per-plate single cell profiles using the following command.
bash
dataset=HeLa
aws s3 cp \
--no-sign-request \
--recursive \
s3://cellpainting-gallery/cpg0021-periscope/broad/workspace/profiles/${dataset}/single_cell/ . \
Download per-guide single cell profiles using the following command.
Note that you can enter a specific guide (e.g. AAAAAAAACCCACCTTTCCG) or a gene name (e.g. HSPA8) to download data for all four of its guides.
While single cell by-guide profiles are relatively small, download may be slow as the download command has to list the whole folder.
bash
dataset=HeLa
guide=AAAAAAAACCCACCTTTCCG
aws s3 cp \
--no-sign-request \
--recursive \
s3://cellpainting-gallery/cpg0021-periscope/broad/workspace/profiles/${dataset}/single_cell/ . \
--exclude "*"
--include "*${guide}*"
Querying Hit Lists
If you would like to query your gene of interest to see if it was called as a hit in our screens by our hit-calling methods, you can search in browser in this repository in the following tables:
1% False Discovery Rate (as described in publication) \ A549 whole profile hits \ A549 compartment specific hits \ HeLa DMEM whole profile hits \ HeLa DMEM compartment specific hits \ HeLa HPLM whole profile hits \ HeLa HPLM compartment specific hits
5% False Discovery Rate (less stringent cutoff than publication) \ A549 whole profile hits \ A549 compartment specific hits \ HeLa DMEM whole profile hits \ HeLa DMEM compartment specific hits \ HeLa HPLM whole profile hits \ HeLa HPLM compartment specific hits
Owner
- Name: Broad Institute
- Login: broadinstitute
- Kind: organization
- Location: Cambridge, MA
- Website: http://www.broadinstitute.org/
- Twitter: broadinstitute
- Repositories: 1,083
- Profile: https://github.com/broadinstitute
Broad Institute of MIT and Harvard
GitHub Events
Total
- Issues event: 8
- Watch event: 6
- Delete event: 1
- Issue comment event: 13
- Push event: 4
- Pull request event: 1
Last Year
- Issues event: 8
- Watch event: 6
- Delete event: 1
- Issue comment event: 13
- Push event: 4
- Pull request event: 1