Science Score: 26.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
  • Academic publication links
  • Academic email domains
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (13.3%) to scientific vocabulary

Keywords

chimera direct-duplex-detection duplex ligation rna rna-duplex rna-rna-interactions splits
Last synced: 7 months ago · JSON representation

Repository

RNAnue

Basic Info
  • Host: GitHub
  • Owner: Ibvt
  • License: gpl-3.0
  • Language: C++
  • Default Branch: master
  • Homepage:
  • Size: 85.9 MB
Statistics
  • Stars: 9
  • Watchers: 4
  • Forks: 4
  • Open Issues: 1
  • Releases: 5
Topics
chimera direct-duplex-detection duplex ligation rna rna-duplex rna-rna-interactions splits
Created over 6 years ago · Last pushed 9 months ago
Metadata Files
Readme Changelog License Citation

README.md

docker-release

RNAnue - 0.2.5

About

RNAnue is a comprehensive analysis to detect RNA-RNA interactions from Direct-Duplex-Detection (DDD) data.

Install

Dependencies

RNAnue has the following dependencies, whereas the brackets indicate the version RNAnue has been build and tested on. Make sure the requirements are satified by your system. cmake is able to detect the Boost libraries system-wide. However, Seqan3 is expected to be located in the current folder of RNAnue as specified in the CMakeLists.txt. Segemehl and the Vienna binaries need to be located in $PATH.

CMake

RNAnue is build using CMake. At first, clone the repository and change into the source directory. git clone https://github.com/Ibvt/RNAnue.git cd RNAnue In the next step, retrieve the SeqAn library and place it in the root folder of RNAnue. CMake is a cross-platform Makefile generator. For that, we provide the CMakeLists to simplify the build process. In particular, it utilizes the instructions given in the CMakeLists. It is recommended to create a "out-of-source build". For that, create a build folder (e.g., ./bin) and cmake into the root directory. cmake ../source/ This is be sufficient if the dependencies are located in $PATH. Calling make builds RNAnue.

Overview

Principle

Usage

Positional Arguments

RNAnue provides different functional arguments (subcalls) for individual procedures. These include RNAnue preproc, RNAnue align, RNAnue clustering, RNAnue analysis. In additon, RNAnue complete applies the whole workflow.

Input

RNAnue requires the sequencing files to be in a specific folder structure. The root folders of the treatments (--trtms) and controls (--ctrls) are specified accordingly. These folders contain subfolders with arbitrary conditions (e.g., treatment, cell lines,...) that in turn contain the read files, e.g.,

./trtms/ condition1 condition2 ./ctrls condition1 condition2 It is to be noted that the --trtms needs to be specified. However, --ctrls may be not set (optional).

Parameters

RNAnue accepts parameter settings both from the commandline and through a configuration file. For the latter, we provide a template configuration file (params.cfg) that allows to set the parameters in a more convenient fashion. This means that the call of RNAnue is reduced to the following call. RNAnue <subcall> --config /path/to/params.cfg Here, subcall corresponds to positional arguments.In any case, the specifying parameters over the command lines has precedence over the config file.

Results

In principle, the results of the analysis are stored in the specified output folder and its subfolders (e.g., ./preproc, ./align, ./clustering, ./analysis). RNAnue reports the split reads in SAM format, the clusters and the RNA-RNA interactions. RNAnue reports the split reads in SAM format. Additionally, the complementarity scores and hybridization energies are stored in the tags FC and FE, respectively. We report the clusters in a custom format that includes the IDs of the clusters, its length, size and genomic coordinates.

Split Reads (.BAM)

RNAnue reports the detected splits in .SAM format (RNAnue detect). In this file, pairs of rows represent the split reads, consisting of the individual segments, e.g

A00551:29:H73LYDSXX:1:1101:7274:10645 16 gi|170079663|ref|NC_010473.1| 3520484 22 1X51= * 0 0 AGGGGTCTTTCCGTCTTGCCGCGGGTACACTGCATCTTCACAGCGAGTTCAA * XA:Z:TTTCTGG XC:f:0.714286 XE:f:-15.6 XL:i:7 XM:i:5 XN:i:0 XR:f:0.0735294 XS:i:5 XX:i:1 XY:i:52 A00551:29:H73LYDSXX:1:1101:7274:10645 16 gi|170079663|ref|NC_010473.1| 3520662 22 11=5S * 0 0 TTCGATCAAGAAGAAC * XA:Z:GAAGAAC XC:f:0.714286 XE:f:-15.6 XL:i:7 XM:i:5 XN:i:0 XR:f:0.0735294 XS:i:5 XX:i:53 XY:i:68

In the following the tags are listed that are reported in the detected split reads. Please note that in the upper segment the alignment is in reverse as done in the calculation of the complemtarity to represent the 3-5 and 5-3 duplex.

| tag | description | | --- | ----------- | | XC:f | complementarity | | XL:f | length of alignment | | XS:i | alignment score | | XM:i | matches in alignment | | XR:f | site length ratio | | XA:Z | alignment of sequence | | XE:f | hybridization energy | | XD:f | MFE structure in dot-bracket notation |

Clustering results

The clustering procedure reports a single clusters.tab file which is a tab-delimited file of the clustering results. Here, each line represents a cluster that corresponds to overlapping split reads, defined by the two segments. The columns are defined in the following:

| Field | Description | | ----- | ----------- | | clustID | Unique identifier of the cluster | | fstsegchr | Chromosome (accession) of the first segment | | fstsegstrd | Strand where the first segment is located | | fstsegstrt | Start position of the first segment in the cluster | | fstsegend | End position of the first segment in the cluster | | secsegchr | Chromosome (accession) of the second segment | | secsegstrd | Strand where the second segment is located | | secsegstrt | Start position of the second segment in the cluster | | secsegend | End position of the second segment in the cluster | | nosplits | Number of split reads in the cluster | | fstseglen | Length of the first segment | | secseg_len | Length of the second segment |

Interaction table

The analysis procedure generates _interactions files for each library in which each line represents an annotated split read that is mapped to a transcript interaction. The fields are defined as follows:

| Field | Description | | ----- | ----------- | | qname | read/template identifier | | fstsegstrd | Strand where the first segment is located | | fstsegstrt | Start position of the first segment | | fstsegend | End position of the first segment | | fstsegref | Reference name of the first segment corresponding to the seqid in GFF and/or clusterID | | fstsegname | Name of the first segment that corresponds to gene name/symbol and/or clusterID | | firstsegbt | Biotype of the annotation transcript (if available) | | fstsegannostrd | Strand information of the transcript in the overlapping annotation | | fstsegprod | Description of the transcript (if available in annotation) | | fstsegori | Orientation of the segment with respect to annotation (sense/antisense) | | secsegstrd | Strand where the second segment is located | | secsegstrt | Start position of the second segment | | secsegend | End position of the second segment | | secsegref | Reference name of the second segment corresponding to the seqid in GFF and/or clusterID | | secsegname | Name of the second segment that corresponds to gene name/symbol and/or clusterID | | secsegbt | Biotype of the annotation transcript (if available) | | secsegannostrd | Strand information of the transcript in the overlapping annotation | | secsegprod | Description of the transcript (if available in annotation) | | secsegori | Orientation of the segment with respect to annotation (sense/antisense) | | cmpl | Complementarity score of the interaction | | fstsegcomplaln | Alignment results in the complementarity calculation of the first segment | | secsegcmplaln | Alignment results in the complementarity calculation of the second segment | | mfe | Hybridisation energy of the interaction | | mfe_struc | Minimum free energy (MFE) structure of interaction in dot-bracket notation |

The main result of an RNAnue analysis are transcript interactions. They are stored in the file allints.txt in the same directory. Its entries are structured as described in the following where columns with prefix are given for each sample specified in the analysis (within the same file).

| Field | Description | |-----------------------| ----------- | | fstrna | Gene/Transcript name of the first interaction partner | | secrna | Gene/Transcript name of the second interaction partner | | fstrnaori | Orientation of the first interaction partner with respect to annotation (sense/antisense) | | secrnaori | Orientation of the second interaction partner with respect to annotation (sense/antisense) | | <sample>suppreads | Number of (split)reads that support the interaction | | <sample>ges | Global energy score (gcs) of the interaction | | <sample>ghs | Global hybridisation score (ghs) of the interaction | | <sample>pval | Statistical significance (p-value) of the interaction | | <library>padj | Benjamini-Hochberg adjusted p-value among the samples |

If the option outcnt is set to 1 RNAnue generates the count table counts.txt in the output directory. It contains the counts of each interaction for each sample and can be used for differential expression analysis. Similarly, outjgf set to 1 generates a graph.json file that contains the detected interactions in JSON graph format. Finally, stats set to 1 creates a stats.txt file that contains basic statistics for each step of the analysis.

Docker

In additon, we provide a ready-to-use Docker container that has RNAnue preconfigured.

Singularity

The provided Docker container can also be used with Singularity. singularity pull docker://cobirna/rnanue:latest singularity exec --bind /path/to/data:/data rnanue_latest.sif RNAnue <subcall> --config /data/params.cfg

Testing

We provide a test dataset in the test folder that can be used to test the installation. For that, test/humanSE.cfg can be used by specifying it in the --config parameter (needs to be absolute path). RNAnue <subcall> --config /path/to/RNAnue/test/humanSE.cfg

Troubleshooting

contact cobi@ibvt.uni-stuttgart.de or create an issue

Owner

  • Name: IBVT
  • Login: Ibvt
  • Kind: organization

Institute of Biochemical Engineering

GitHub Events

Total
  • Create event: 6
  • Release event: 2
  • Issues event: 5
  • Watch event: 1
  • Delete event: 3
  • Issue comment event: 6
  • Push event: 17
  • Pull request event: 4
Last Year
  • Create event: 6
  • Release event: 2
  • Issues event: 5
  • Watch event: 1
  • Delete event: 3
  • Issue comment event: 6
  • Push event: 17
  • Pull request event: 4

Dependencies

.github/workflows/docker.yml actions
  • actions/checkout v3 composite
  • docker/ * composite
  • docker/build-push-action v4 composite
  • docker/build-push-action v2 composite
  • docker/setup-buildx-action v2 composite
Dockerfile docker
  • ubuntu 23.04 build