OSTIR

OSTIR: open source translation initiation rate prediction - Published in JOSS (2021)

https://github.com/barricklab/ostir

Science Score: 100.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
    Found CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
    Found 1 DOI reference(s) in JOSS metadata
  • Academic publication links
    Links to: joss.theoj.org
  • Committers with academic emails
    2 of 5 committers (40.0%) from academic institutions
  • Institutional organization owner
  • JOSS paper metadata
    Published in Journal of Open Source Software

Keywords

bioengineering rna-structure synthetic-biology
Last synced: 9 months ago · JSON representation ·

Repository

Software for predicting translation initiation rates in bacteria

Basic Info
  • Host: GitHub
  • Owner: barricklab
  • License: gpl-3.0
  • Language: Python
  • Default Branch: master
  • Homepage:
  • Size: 6.85 MB
Statistics
  • Stars: 29
  • Watchers: 3
  • Forks: 9
  • Open Issues: 3
  • Releases: 8
Topics
bioengineering rna-structure synthetic-biology
Created about 7 years ago · Last pushed 10 months ago
Metadata Files
Readme License Citation Zenodo

README.md

OSTIR (Open Source Translation Initiation Rates)

Status Bioconda Anaconda Badge

OSTIR is a Python package for predicting the rates at which ribosomes will bind to and initiate translation from different start codons in bacterial mRNAs. It uses the ViennaRNA Package to perform the necessary free energy calculations. The code builds on the last open source version of the RBS calculator.

OSTIR includes several improvements in usability. It supports multi-FASTA input with command line parameters or CSV input that can define parameters on a per-sequence basis. Additionally, OSTIR supports multi-threaded execution, accelerating the analysis of very large sequences.

Please see the OSTIR Wiki for full documentation

Quickstart

Installation

Step by step

install with bioconda

OSTIR is a Python module and associated command line script. We recommend installing OSTIR using Bioconda on Linux or macOS. This will automatically install OSTIR and all of its dependencies, including ViennaRNA and the required Python modules.

From Bioconda (recommended; Linux, macOS): - Run conda install -c bioconda ostir

From Pip (for experts; Linux, macOS, Windows): - Download and install ViennaRNA, following the instructions here. - Run pip install ostir

For information on installing for development see the Wiki Documentation.

Docker

For an express run and assuming there is Docker in your system you may:

docker build . -t ostir:latest docker run -it ostir

You should see ostir -h output

Note: By default Dockerfile is linked to Dockerfile.miniforge so that miniforge is being used to install conda. If you want any other installer (Miniconda or Anaconda), please rename/link at your best convenience.

Command Line Usage

Print OSTIR help: ostir -h

Run OSTIR on a sequence provided at the command line and print output to the console: ostir -i TTCTAGATGAGAATAAGGTTATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGT

Run OSTIR on all sequences provided in a FASTA file and print output to a CSV file: ostir -i input.fasta -o output.csv

More options and examples are described in the Wiki Documentation.

Python Module Usage

Run OSTIR on a sequence inside of a Python script:

```python3 from ostir import run_ostir

seq = "ACUUCUAAUUUAUUCUAUUUAUUCGCGGAUAUGCAUAGGAGUGCUUCGAUGUCAU" results = runostir(seq, name="mysequence", threads=8) print(results) ```

More options and examples are described in the Wiki Documentation.

Owner

  • Name: Barrick Lab
  • Login: barricklab
  • Kind: organization
  • Location: Austin, TX

Barrick Lab at the University of Texas at Austin

JOSS Publication

OSTIR: open source translation initiation rate prediction
Published
August 22, 2021
Volume 6, Issue 64, Page 3362
Authors
Cameron T. Roots ORCID
Department of Molecular Biosciences, Center for Systems and Synthetic Biology, The University of Texas at Austin
Alexandra Lukasiewicz
McKetta Department of Chemical Engineering, The University of Texas at Austin
Jeffrey E. Barrick ORCID
Department of Molecular Biosciences, Center for Systems and Synthetic Biology, The University of Texas at Austin
Editor
Charlotte Soneson ORCID
Tags
synthetic biology systems biology bioengineering ribosome binding site translation calculator

Citation (CITATION.cff)

cff-version: 1.2.0
message: If you use this software, please cite it using these metadata.
title: "OSTIR: open source translation initiation rates prediction"
abstract: Translation of messenger RNAs into proteins by the ribosome is a fundamental step in gene expression. In bacteria, it is possible to accurately predict the rate of translation initiation from the sequence surrounding a gene's start codon using thermodynamic models of RNA folding and ribosome binding. These predictions have applications in a range of fields, from systems biology studies that aim to understand and model bacterial physiology to synthetic biology studies that seek to reprogram bacterial cells. For example, metabolic engineers can design ribosome binding site (RBS) sequences to tune the expression of different enzymes in a pathway and thereby optimize the production of a desired chemical compound by cells. OSTIR (Open Source Translation Initiation Rates) is a Python package and command line tool for predicting translation initiation rates in bacteria.
authors:
- family-names: "Roots"
  given-names: "Cameron T."
  orcid: "https://orcid.org/0000-0001-6219-3168"
- family-names: "Lukasiewicz"
  given-names: "Alexandra"
- family-names: "Barrick"
  given-names: "Jeffrey E."
  orcid: "https://orcid.org/0000-0003-0888-7358"
version: 1.0.6
date-released: "2021-08-20"
identifiers:
  - description: This is the collection of archived snapshots of all versions of OSTIR
    type: doi
    value: "10.5281/zenodo.5227844"
  - description: This is the archived snapshot of the JOSS published version 1.0.6 of OSTIR
    type: doi
    value: "10.5281/zenodo.5227845"
license: GPL-3.0
repository-code: "https://github.com/barricklab/ostir"
preferred-citation:
  type: article
  authors:
  - family-names: "Roots"
    given-names: "Cameron T."
    orcid: "https://orcid.org/0000-0001-6219-3168"
  - family-names: "Lukasiewicz"
    given-names: "Alexandra"
  - family-names: "Barrick"
    given-names: "Jeffrey E."
    orcid: "https://orcid.org/0000-0003-0888-7358"
  doi: "10.21105/joss.03362"
  journal: "Journal of Open Source Software"
  month: 8
  start: 3362 # First page number
  title: "OSTIR: open source translation initiation rate prediction"
  issue: 6
  volume: 64
  year: 2021

GitHub Events

Total
  • Release event: 1
  • Watch event: 7
  • Issue comment event: 7
  • Push event: 15
  • Pull request event: 2
  • Create event: 2
Last Year
  • Release event: 1
  • Watch event: 7
  • Issue comment event: 7
  • Push event: 15
  • Pull request event: 2
  • Create event: 2

Committers

Last synced: 10 months ago

All Time
  • Total Commits: 159
  • Total Committers: 5
  • Avg Commits per committer: 31.8
  • Development Distribution Score (DDS): 0.314
Past Year
  • Commits: 19
  • Committers: 2
  • Avg Commits per committer: 9.5
  • Development Distribution Score (DDS): 0.053
Top Committers
Name Email Commits
Cameron c****s@u****u 109
Jeffrey Barrick j****k@g****m 46
ajlukasiewicz a****z@u****u 2
Yiduo Wang 6****2 1
Luilver Garcés Briñas l****r@g****m 1
Committer Domains (Top 20 + Academic)

Issues and Pull Requests

Last synced: 9 months ago

All Time
  • Total issues: 9
  • Total pull requests: 5
  • Average time to close issues: 3 months
  • Average time to close pull requests: 12 days
  • Total issue authors: 6
  • Total pull request authors: 4
  • Average comments per issue: 1.33
  • Average comments per pull request: 1.0
  • Merged pull requests: 5
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 0
  • Pull requests: 2
  • Average time to close issues: N/A
  • Average time to close pull requests: about 1 month
  • Issue authors: 0
  • Pull request authors: 2
  • Average comments per issue: 0
  • Average comments per pull request: 2.0
  • Merged pull requests: 2
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • jeffreybarrick (3)
  • jhahnfeld (2)
  • croots (1)
  • luilver (1)
  • cclough (1)
  • biseiohkawara (1)
Pull Request Authors
  • croots (3)
  • yiduo-wang-32 (2)
  • luilver (2)
  • ajlukasiewicz (1)
Top Labels
Issue Labels
enhancement (2) help wanted (1)
Pull Request Labels

Packages

  • Total packages: 3
  • Total downloads:
    • pypi 253 last-month
  • Total dependent packages: 1
    (may contain duplicates)
  • Total dependent repositories: 1
    (may contain duplicates)
  • Total versions: 14
  • Total maintainers: 2
pypi.org: ostir50

Open Source Transcription Initiation Rates

  • Versions: 1
  • Dependent Packages: 0
  • Dependent Repositories: 0
  • Downloads: 0
Rankings
Dependent packages count: 4.8%
Dependent repos count: 6.3%
Forks count: 14.4%
Stargazers count: 18.2%
Average: 18.9%
Downloads: 50.9%
Last synced: over 1 year ago
pypi.org: ostir-50

Open Source Transcription Initiation Rates

  • Versions: 1
  • Dependent Packages: 0
  • Dependent Repositories: 0
  • Downloads: 0
Rankings
Dependent packages count: 4.8%
Dependent repos count: 6.3%
Forks count: 14.4%
Stargazers count: 18.2%
Average: 18.9%
Downloads: 50.9%
Last synced: over 1 year ago
pypi.org: ostir

Open Source Transcription Initiation Rates

  • Versions: 12
  • Dependent Packages: 1
  • Dependent Repositories: 1
  • Downloads: 253 Last month
Rankings
Dependent packages count: 10.1%
Forks count: 15.4%
Stargazers count: 18.5%
Average: 19.0%
Dependent repos count: 21.6%
Downloads: 29.4%
Maintainers (2)
Last synced: 9 months ago

Dependencies

.github/workflows/package_and_test.yml actions
  • actions/checkout v2 composite
setup.py pypi
  • numpy *
.github/workflows/python_publish.yml actions
  • actions/checkout v3 composite
  • actions/setup-python v3 composite
  • pypa/gh-action-pypi-publish 27b31702a0e7fc50959f5ad993c78deac1bdfc29 composite
environment.yml pypi
pyproject.toml pypi