OSTIR
OSTIR: open source translation initiation rate prediction - Published in JOSS (2021)
Science Score: 100.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
✓CITATION.cff file
Found CITATION.cff file -
✓codemeta.json file
Found codemeta.json file -
✓.zenodo.json file
Found .zenodo.json file -
✓DOI references
Found 1 DOI reference(s) in JOSS metadata -
✓Academic publication links
Links to: joss.theoj.org -
✓Committers with academic emails
2 of 5 committers (40.0%) from academic institutions -
○Institutional organization owner
-
✓JOSS paper metadata
Published in Journal of Open Source Software
Keywords
Repository
Software for predicting translation initiation rates in bacteria
Basic Info
Statistics
- Stars: 29
- Watchers: 3
- Forks: 9
- Open Issues: 3
- Releases: 8
Topics
Metadata Files
README.md
OSTIR (Open Source Translation Initiation Rates)
OSTIR is a
Python package for predicting the rates at which ribosomes will bind to and initiate
translation from different start codons in bacterial mRNAs. It uses the ViennaRNA Package to perform
the necessary free energy calculations. The code builds on the last open source version of the
RBS calculator.
OSTIR includes several improvements in usability. It supports multi-FASTA
input with command line parameters or CSV input that can define
parameters on a per-sequence basis. Additionally, OSTIR supports multi-threaded
execution, accelerating the analysis of very large sequences.
Please see the OSTIR Wiki for full documentation
Quickstart
Installation
Step by step
OSTIR is a Python module and associated command line script. We recommend installing OSTIR using Bioconda on Linux or macOS. This will automatically install OSTIR and all of its dependencies, including ViennaRNA and the required Python modules.
From Bioconda (recommended; Linux, macOS):
- Run conda install -c bioconda ostir
From Pip (for experts; Linux, macOS, Windows):
- Download and install ViennaRNA, following the instructions here.
- Run pip install ostir
For information on installing for development see the Wiki Documentation.
Docker
For an express run and assuming there is Docker in your system you may:
docker build . -t ostir:latest
docker run -it ostir
You should see ostir -h output
Note: By default Dockerfile is linked to Dockerfile.miniforge so that miniforge is being used to install conda. If you want any other installer (Miniconda or Anaconda), please rename/link at your best convenience.
Command Line Usage
Print OSTIR help:
ostir -h
Run OSTIR on a sequence provided at the command line and print output to the console:
ostir -i TTCTAGATGAGAATAAGGTTATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGT
Run OSTIR on all sequences provided in a FASTA file and print output to a CSV file:
ostir -i input.fasta -o output.csv
More options and examples are described in the Wiki Documentation.
Python Module Usage
Run OSTIR on a sequence inside of a Python script:
```python3 from ostir import run_ostir
seq = "ACUUCUAAUUUAUUCUAUUUAUUCGCGGAUAUGCAUAGGAGUGCUUCGAUGUCAU" results = runostir(seq, name="mysequence", threads=8) print(results) ```
More options and examples are described in the Wiki Documentation.
Owner
- Name: Barrick Lab
- Login: barricklab
- Kind: organization
- Location: Austin, TX
- Website: http://barricklab.org
- Repositories: 15
- Profile: https://github.com/barricklab
Barrick Lab at the University of Texas at Austin
JOSS Publication
OSTIR: open source translation initiation rate prediction
Authors
Department of Molecular Biosciences, Center for Systems and Synthetic Biology, The University of Texas at Austin
McKetta Department of Chemical Engineering, The University of Texas at Austin
Tags
synthetic biology systems biology bioengineering ribosome binding site translation calculatorCitation (CITATION.cff)
cff-version: 1.2.0
message: If you use this software, please cite it using these metadata.
title: "OSTIR: open source translation initiation rates prediction"
abstract: Translation of messenger RNAs into proteins by the ribosome is a fundamental step in gene expression. In bacteria, it is possible to accurately predict the rate of translation initiation from the sequence surrounding a gene's start codon using thermodynamic models of RNA folding and ribosome binding. These predictions have applications in a range of fields, from systems biology studies that aim to understand and model bacterial physiology to synthetic biology studies that seek to reprogram bacterial cells. For example, metabolic engineers can design ribosome binding site (RBS) sequences to tune the expression of different enzymes in a pathway and thereby optimize the production of a desired chemical compound by cells. OSTIR (Open Source Translation Initiation Rates) is a Python package and command line tool for predicting translation initiation rates in bacteria.
authors:
- family-names: "Roots"
given-names: "Cameron T."
orcid: "https://orcid.org/0000-0001-6219-3168"
- family-names: "Lukasiewicz"
given-names: "Alexandra"
- family-names: "Barrick"
given-names: "Jeffrey E."
orcid: "https://orcid.org/0000-0003-0888-7358"
version: 1.0.6
date-released: "2021-08-20"
identifiers:
- description: This is the collection of archived snapshots of all versions of OSTIR
type: doi
value: "10.5281/zenodo.5227844"
- description: This is the archived snapshot of the JOSS published version 1.0.6 of OSTIR
type: doi
value: "10.5281/zenodo.5227845"
license: GPL-3.0
repository-code: "https://github.com/barricklab/ostir"
preferred-citation:
type: article
authors:
- family-names: "Roots"
given-names: "Cameron T."
orcid: "https://orcid.org/0000-0001-6219-3168"
- family-names: "Lukasiewicz"
given-names: "Alexandra"
- family-names: "Barrick"
given-names: "Jeffrey E."
orcid: "https://orcid.org/0000-0003-0888-7358"
doi: "10.21105/joss.03362"
journal: "Journal of Open Source Software"
month: 8
start: 3362 # First page number
title: "OSTIR: open source translation initiation rate prediction"
issue: 6
volume: 64
year: 2021
GitHub Events
Total
- Release event: 1
- Watch event: 7
- Issue comment event: 7
- Push event: 15
- Pull request event: 2
- Create event: 2
Last Year
- Release event: 1
- Watch event: 7
- Issue comment event: 7
- Push event: 15
- Pull request event: 2
- Create event: 2
Committers
Last synced: 10 months ago
Top Committers
| Name | Commits | |
|---|---|---|
| Cameron | c****s@u****u | 109 |
| Jeffrey Barrick | j****k@g****m | 46 |
| ajlukasiewicz | a****z@u****u | 2 |
| Yiduo Wang | 6****2 | 1 |
| Luilver Garcés Briñas | l****r@g****m | 1 |
Committer Domains (Top 20 + Academic)
Issues and Pull Requests
Last synced: 9 months ago
All Time
- Total issues: 9
- Total pull requests: 5
- Average time to close issues: 3 months
- Average time to close pull requests: 12 days
- Total issue authors: 6
- Total pull request authors: 4
- Average comments per issue: 1.33
- Average comments per pull request: 1.0
- Merged pull requests: 5
- Bot issues: 0
- Bot pull requests: 0
Past Year
- Issues: 0
- Pull requests: 2
- Average time to close issues: N/A
- Average time to close pull requests: about 1 month
- Issue authors: 0
- Pull request authors: 2
- Average comments per issue: 0
- Average comments per pull request: 2.0
- Merged pull requests: 2
- Bot issues: 0
- Bot pull requests: 0
Top Authors
Issue Authors
- jeffreybarrick (3)
- jhahnfeld (2)
- croots (1)
- luilver (1)
- cclough (1)
- biseiohkawara (1)
Pull Request Authors
- croots (3)
- yiduo-wang-32 (2)
- luilver (2)
- ajlukasiewicz (1)
Top Labels
Issue Labels
Pull Request Labels
Packages
- Total packages: 3
-
Total downloads:
- pypi 253 last-month
-
Total dependent packages: 1
(may contain duplicates) -
Total dependent repositories: 1
(may contain duplicates) - Total versions: 14
- Total maintainers: 2
pypi.org: ostir50
Open Source Transcription Initiation Rates
- Homepage: https://github.com/barricklab/ostir
- Documentation: https://ostir50.readthedocs.io/
- License: GNU General Public License v3 or later (GPLv3+)
-
Latest release: 1.0.6
published almost 4 years ago
Rankings
pypi.org: ostir-50
Open Source Transcription Initiation Rates
- Homepage: https://github.com/barricklab/ostir
- Documentation: https://ostir-50.readthedocs.io/
- License: GNU General Public License v3 or later (GPLv3+)
-
Latest release: 1.0.6
published almost 4 years ago
Rankings
pypi.org: ostir
Open Source Transcription Initiation Rates
- Homepage: https://github.com/barricklab/ostir
- Documentation: https://ostir.readthedocs.io/
- License: GNU General Public License v3 or later (GPLv3+)
-
Latest release: 1.1.3
published over 1 year ago
Rankings
Dependencies
- actions/checkout v2 composite
- numpy *
- actions/checkout v3 composite
- actions/setup-python v3 composite
- pypa/gh-action-pypi-publish 27b31702a0e7fc50959f5ad993c78deac1bdfc29 composite