https://github.com/clinical-genomics/stranger

Tool to annotate outfiles from ExpansionHunter and TRGT with the pathologic implications of the repeat

https://github.com/clinical-genomics/stranger

Science Score: 36.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
  • Academic publication links
    Links to: zenodo.org
  • Committers with academic emails
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (14.8%) to scientific vocabulary

Keywords

bioinformatics long-read long-read-sequencing massively-parallel-sequencing short-tandem-repeats
Last synced: 9 months ago · JSON representation

Repository

Tool to annotate outfiles from ExpansionHunter and TRGT with the pathologic implications of the repeat

Basic Info
  • Host: GitHub
  • Owner: Clinical-Genomics
  • License: mit
  • Language: Python
  • Default Branch: main
  • Homepage:
  • Size: 494 KB
Statistics
  • Stars: 33
  • Watchers: 6
  • Forks: 6
  • Open Issues: 8
  • Releases: 17
Topics
bioinformatics long-read long-read-sequencing massively-parallel-sequencing short-tandem-repeats
Created over 7 years ago · Last pushed 10 months ago
Metadata Files
Readme Changelog License

README.md

Stranger

Build Status - GitHub PyPI Version DOI GitHub Release Date Coverage Status Code style: black Woke

Annotates output files from ExpansionHunter and TRGT with the pathologic implications of the repeat sizes.

Installation

Stranger uses the uv project manager. It is very quick and lightweight - see the uv installation instructions.

git clone github.com/clinical-genomics/stranger cd stranger uv pip install --editable .

Usage

``` uv run stranger --help Usage: stranger [OPTIONS] VCF

Annotate str variants with str status

Options: -f, --repeats-file PATH Path to a file with repeat definitions. See README for explanation [default: $HOME/ stranger/stranger/resources/vari antcataloggrch37.json] -i, --family_id TEXT -t, --trgt File was produced with TRGT --version --loglevel [DEBUG|INFO|WARNING|ERROR|CRITICAL] Set the level of log output. [default: INFO] --help Show this message and exit. ```

Repeat definitions

The repeats are called with Expansion Hunter as mentioned earlier. ExpansionHunter will annotate the number of times that a repeat has been seen in the bam files of each individual and what repeat id the variant has. Stranger will annotate the level of pathogenicity for the repeat number. The intervals that comes with the package are manually collected from the literature since there is no single source where this information can be collected.

You can find a demo repeat definitions json file that comes with Stranger here. It is based on the ExpansionHunter variant catalog, but extended with a few disease locus relevant keys: It is advisable to use an up to date file, perhaps based on a curated public repostitory such as STRchive or STRipy. The ones we use in our routine pipelines can be found at our Reference-files repository and include our literature curation.

| Column/Key | Content/Value | |-----------------|-------------------------------------------------------------------------------------------------| | HGNCID | HGNC identifier for the repeat or most associated gene. | | HGNCSYMBOL | HGNC symbol for the repeat or most associated gene. | | REPID | ExpansionHunter repeat ID. | | RU | Basic repeat unit, as seen in ExpansionHunter. Unused. | | DisplayRU | Repeat unit, as clinicians are used to see it. | | NormalMax | (#copies) Longest repeat expected for normal individual; higher are marked pre- or full-mutation | | PathologicMin | (#copies) Shortest repeat expected for pathology. This and higher is annotated as full-mutation. | | Disease | Associated disease. | | InheritanceMode | Mode of inheritance "AR", "AD", "XR" etc | | Source | Reference literature resource type, eg GeneReviews or PubMed | | SourceId | PMID or GeneReviews book ID for references | | TRID | Trgt repeat ID if not same as REPID | | PathologicStruc | Array of index for pathogenic motif |

Other fields accepted by ExpansionHunter are also encouraged.

For convenience, here is a formatted table with some of the current contents. | HGNCId | LocusId | DisplayRU | InheritanceMode | normal_max | pathologic_min | Disease | SourceDisplay | SourceId | | ------- | ------- | ------- | ------- | ------- | ------- | ------- | ------- | ------- | | 3776 | AFF2 | CCG | XR | 39 | 200 | Fraxe | GeneReviews Internet 2019-11-07 | NBK535148 | | 644 | AR | CAG | XR | 34 | 38 | SBMA | GeneReviews Internet 2019-11-07 | NBK535148 | | 18060 | ARX_EIEE | GCN | XR | 16 | 17 | EIEE | GeneReviews Internet 2019-11-07 | NBK535148 | | 18060 | ARX_PRTS | GCN | XR | 12 | 20 | PRTS | GeneReviews Internet 2019-11-07 | NBK535148 | | 3033 | ATN1 | CAG | AD | 35 | 48 | DRPLA | GeneReviews Internet 2019-11-07 | NBK535148 | | 10549 | ATXN10 | ATTCT | AD | 32 | 800 | SCA10 | GeneReviews Internet 2019-11-07 | NBK535148 | | 10548 | ATXN1 | CAG | AD | 35 | 45 | SCA1 | GeneReviews Internet SCA1 2017-06-22 | NBK1184 | | 10555 | ATXN2 | CAG | AD | 31 | 37 | SCA2 | GeneReviews Internet SCA2 2019-02-14 | NBK1275 | | 7106 | ATXN3 | CAG | AD | 44 | 60 | MJD | GeneReviews Internet 2019-11-07 | NBK535148 | | 10560 | ATXN7 | CAG | AD | 19 | 36 | SCA7 | GeneReviews Internet 2019-11-07 | NBK535148 | | 10561 | ATXN8OS | CTG | AD | 50 | 80 | SCA8 | GeneReviews Internet 2019-11-07 | NBK535148 | | 28337 | C9ORF72 | GGCCCC | AD | 25 | 40 | FTDALS1 | GeneReviews Internet 2019-11-07 | NBK535148 | | 1388 | CACNA1A | CAG | AD | 18 | 20 | SCA6 | GeneReviews Internet 2019-11-07 | NBK535148 | | 1541 | CBL | CCG | AD | 79 | 100 | FRAX11B | Jones et al Nature 1995 | 7603564 | | 1541 | BEAN1 | TGGAA | AD | 10 | 40 | SCA31 | Sato et al AJHG 2009 | 7603564 | | 13164 | CNBP | CCTG | AD | 30 | 75 | DM2 | GeneReviews Internet 2020-03-19 | NBK1466 | | 2482 | CSTB | CCCCGCCCCGCG | AR | 3 | 30 | EPM1 | GeneReviews Internet 2019-11-07 | NBK535148 | | 2482 | DAB1 | ATTTC | AD | 16 | 31 | SCA37 | GeneReviews Internet 2019-05-30 | NBK541729 | | 29284 | DIP2B | CGG | AD | 24 | 270 | FRA12A | GeneReviews Internet 2019-11-07 | NBK535148 | | 2933 | DMPK | CTG | AD | 34 | 50 | DM1 | GeneReviews Internet 2019-10-03 | NBK1165 | | 18683 | EIF4A3 | TCGGCAGCGGCGCAGCGAGG | AR | 9 | 10 | RCPS | GeneReviews Internet 2019-11-07 | NBK535148 | | 3775 | FMR1 | CGG | XR | 55 | 200 | FragileX | GeneReviews Internet 2019-11-07 | NBK535148 | | 1092 | FOXL2 | GCN | AD | 14 | 15 | BPES | GeneReviews Internet 2019-11-07 | NBK535148 | | 3951 | FXN | GAA | AR | 35 | 51 | FRDA | GeneReviews Internet 2019-11-07 | NBK535148 | | 4331 | GLS | GCA | AR | 20 | 90 | GDPAG | van Kuilenburg et al (2019) NEJM 380:1433-1441 | 30970188 | | 5102 | HOXA13_I | GCN | AD | 14 | 22 | HFGS | GeneReviews Internet 2019-08-08 | NBK1423 | | 5102 | HOXA13_II | GCN | AD | 12 | 18 | HFGS | GeneReviews Internet 2019-08-08 | NBK1423 | | 5102 | HOXA13_III | GCN | AD | 18 | 24 | HFGS | GeneReviews Internet 2019-08-08 | NBK1423 | | 5136 | HOXD13 | GCN | AD | 15 | 22 | SDTY5 | GeneReviews Internet 2019-11-07 | NBK535148 | | 4851 | HTT | CAG | AD | 36 | 40 | Huntington | GeneReviews Internet 2020-06-11 | NBK1305 | | 14203 | JPH3 | CTG | AD | 28 | 40 | HDL2 | GeneReviews Internet 2019-06-27 | NBK1529 | | 31708 | LRP12 | CGN | AD | 45 | 90 | OPDM1 | GeneReviews Internet 2019-11-07 | NBK535148 | | 1226 | GIPC1 | GGC | AD | 32 | 73 | OPDM2 | Deng et al (2020) AJHG 106(6):793-804 | 32413282 | | 17043 | NIPA1 | GCN | AD | 8 | 10000 | ALS - susceptibility to | Tazelaar et al (2019) Neurobiol Aging 74:234.e9-234.e15 | 30342764 | | 15911 | NOP56 | GGCCTG | AD | 14 | 650 | SCA36 | GeneReviews Internet 2014-08-07 | NBK231880 | | 53924 | NOTCH2NLC | CGG | AD | 38 | 66 | NIID | GeneReviews Internet 2019-11-07 | NBK535148 | | 8565 | PABPN1 | GCN | AD | 10 | 12 | OPMD | GeneReviews Internet 2014-02-20 | NBK1126 | | 9143 | PHOX2B | GCN | AD | 20 | 25 | CCHS | GeneReviews Internet 2014-01-30 | NBK1427 | | 9305 | PPP2R2B | CAG | AD | 32 | 51 | SCA12 | GeneReviews Internet 2019-11-07 | NBK535148 | | 16854 | RAPGEF2 | TTTCA | AD | 1 | 10 | FAME7 | Ishiura et al (2018) Nature Genetics 50;581-90 | 29507423 | | 9969 | RFC1 | AARRG | AR | 11 | 12 | CANVAS | Cortese et al 2019 Nat Gen PMID: 30926972 | 30926972 | | 31750 | SAMD12 | TTTCA | AD | 1 | 10 | FAME1 | Ishiura et al (2018) Nature Genetics 50;581-90 | 29507423 | | 10472 | RUNX2 | GCN | AD | 17 | 20 | CCD | GeneReviews Internet 2019-11-07 | NBK535148 | | 11199 | SOX3 | GCN | XR | 15 | 22 | MRGH | GeneReviews Internet 2019-11-07 | NBK535148 | | 11588 | TBP | CAN | AD | 40 | 49 | SCA17 | GeneReviews Internet 2019-09-12 | NBK1438 | | 11592 | TBX1 | GCN | AD | 15 | 25 | TOF | GeneReviews Internet 2019-11-07 | NBK535148 | | 11634 | TCF4 | CTG | AD | 39 | 100 | FECD3 | GeneReviews Internet 2019-11-07 | NBK535148 | | 11969 | TNRC6A | TTTCA | AD | 1 | 10 | FAME6 | Ishiura et al (2018) Nature Genetics 50;581-90 | 29507423 | | 15516 | XYLT1 | GGC | AR | 20 | 70 | DBQD2 | LaCroix et al (2018) AJHG 104(1):35-44 | 30554721 | | 12873 | ZIC2 | GCN | AD | 15 | 25 | HPE5 | GeneReviews Internet 2019-11-07 | NBK535148 | | 12874 | ZIC3 | GCN | XR | 10 | 12 | VACTERLX | GeneReviews Internet 2019-11-07 | NBK535148 | | 9179 | POLG | CTG | - | 15 | 10000 | - | Research only. Contact CMMS, KUH, regarding findings. | CMMS |

Stranger can also read a legacy .tsv format file, structured like a Scout gene panel, with STR specific columns. The column names and keys correspond, but if in any kind of doubt, please read the code or use the json version.

As a default the file that follows the distribution is used but the users can create their own file. Header line(s) should be preceded with a #.

It is also possible to use an ExpansionHunter variant catalog json file with corresponding keys added. E.g. [ { "VariantType": "Repeat", "LocusId": "ATXN2", "LocusStructure": "(GCT)*", "ReferenceRegion": "chr12:112036753-112036822", "Disease": "SCA2", "NormalMax": 31, "PathologicMin": 39 }, { "VariantType": "Repeat", "LocusId": "PABPN1", "LocusStructure": "(GCG)*", "ReferenceRegion": "chr14:23790681-23790699", "Disease": "OPMD", "NormalMax": 6, "PathologicMin": 9 } ]

Such files are also provided with the distribution. PRs with updates are much appreciated.

Output

Output is by annotated VCF, with keys STR_STATUS, NormalMax and PathologicMin.

```

INFO=

4 3076603 . C , . PASS END=3076660;REF=19;RL=57;RU=CAG;VARID=HTT;REPID=HTT;STR_STATUS=normal,normal ```

TRGT mode

The flag --trgt will instruct Stranger to accept TRGT style VCFs. In particular, motif copy numbers are parsed from the GT.MC field and motifs listed in the PathologicStruc entry of the reference catalog: JSON { "VariantType": "Repeat", "LocusId": "RAPGEF2", "HGNCId": 16854, "InheritanceMode": "AD", "DisplayRU": "TTTCA", "SourceDisplay": "Ishiura et al (2018) Nature Genetics 50 581-90", "Source": "PubMed", "SourceId": "29507423", "LocusStructure": "(TTTTA)*(TTTCA)*(TTTTA)*", "ReferenceRegion": [ "4:160263679-160263703", "4:160263704-160263708", "4:160263709-160263768" ], "VariantType": [ "Repeat", "Repeat", "Repeat" ], "VariantId": [ "RAPGEF2_TTTTA_5P", "RAPGEF2", "RAPGEF2_TTTTA_3P" ], "PathologicRegion": "4:160263704-160263708", "PathologicStruc": [1], "Disease": "FAME7", "NormalMax": 1, "PathologicMin": 10 }, and ```VCF ...

FORMAT=

... 4 160263680 . TTTATTTTATTTTATTTTATTTTATATTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT . 0 . TRID=FAME7RAPGEF2;END=160263770;MOTIFS=TTTTA,TTTCA;STRUC=(TTTTA)n(TTTCA)n(TTTTA)n;STRSTATUS=fullmutation;STRNORMALMAX=1;STRPATHOLOGICMIN=10;RankScore=internalid3:30;HGNCId=16854;InheritanceMode=AD;DisplayRU=TTTCA;SourceDisplay=Ishiura et al (2018) Nature Genetics 50 581-90;Source=PubMed;SourceId=29507423;Disease=FAME7 GT:AL:ALLR:SD:MC:MS:AP:AM 0/0:91,91:85-98,91-91:21,20:180,180:0(0-89)1(89-89)0(89-89),0(0-89)1(89-89)0(89-89):0.956044,0.956044:.,. 0/0:91,91:85-98,91-91:21,20:180,180:0(0-89)1(89-89)0(89-89),0(0-89)1(89-89)0(89-89):0.956044,0.956044:.,. 0/0:91,91:85-98,91-91:21,20:180,180:0(0-89)1(89-89)0(89-89),0(0-89)1(89-89)_0(89-89):0.956044,0.956044:.,. ... ```

Owner

  • Name: Clinical Genomics
  • Login: Clinical-Genomics
  • Kind: organization
  • Location: Stockholm, Sweden

GitHub Events

Total
  • Create event: 10
  • Release event: 2
  • Issues event: 13
  • Watch event: 4
  • Delete event: 2
  • Issue comment event: 17
  • Push event: 42
  • Pull request review comment event: 10
  • Pull request review event: 18
  • Pull request event: 19
Last Year
  • Create event: 10
  • Release event: 2
  • Issues event: 13
  • Watch event: 4
  • Delete event: 2
  • Issue comment event: 17
  • Push event: 42
  • Pull request review comment event: 10
  • Pull request review event: 18
  • Pull request event: 19

Committers

Last synced: about 1 year ago

All Time
  • Total Commits: 192
  • Total Committers: 6
  • Avg Commits per committer: 32.0
  • Development Distribution Score (DDS): 0.266
Past Year
  • Commits: 70
  • Committers: 2
  • Avg Commits per committer: 35.0
  • Development Distribution Score (DDS): 0.171
Top Committers
Name Email Commits
Daniel Nilsson d****n@g****m 141
Måns Magnusson m****n@s****e 20
fellen31 f****r@g****m 16
Lint Action l****n@s****m 12
Björn Hallström b****m@s****e 2
George Carvalho g****1@g****m 1
Committer Domains (Top 20 + Academic)

Issues and Pull Requests

Last synced: 10 months ago

All Time
  • Total issues: 48
  • Total pull requests: 53
  • Average time to close issues: about 1 month
  • Average time to close pull requests: 18 days
  • Total issue authors: 12
  • Total pull request authors: 5
  • Average comments per issue: 1.1
  • Average comments per pull request: 0.96
  • Merged pull requests: 48
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 15
  • Pull requests: 23
  • Average time to close issues: 29 days
  • Average time to close pull requests: about 12 hours
  • Issue authors: 5
  • Pull request authors: 2
  • Average comments per issue: 1.07
  • Average comments per pull request: 1.3
  • Merged pull requests: 19
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • dnil (28)
  • bw2 (4)
  • fellen31 (4)
  • Stikus (2)
  • moonso (1)
  • A97paupic (1)
  • Schmytzi (1)
  • ViktorHy (1)
  • ehre (1)
  • anuravi1234 (1)
  • bopohdr (1)
  • cogrho (1)
Pull Request Authors
  • dnil (65)
  • fellen31 (6)
  • moonso (2)
  • geocarvalho (2)
  • bjhall (1)
Top Labels
Issue Labels
enhancement (4) bug (1)
Pull Request Labels

Packages

  • Total packages: 1
  • Total downloads:
    • pypi 193 last-month
  • Total dependent packages: 0
  • Total dependent repositories: 2
  • Total versions: 20
  • Total maintainers: 3
pypi.org: stranger

Annotate VCF files with STR variants with pathogenicity implications

  • Versions: 20
  • Dependent Packages: 0
  • Dependent Repositories: 2
  • Downloads: 193 Last month
Rankings
Dependent packages count: 10.1%
Dependent repos count: 11.6%
Stargazers count: 12.4%
Forks count: 14.2%
Average: 19.0%
Downloads: 47.0%
Maintainers (3)
Last synced: 10 months ago

Dependencies

Dockerfile docker
  • continuumio/miniconda3 23.3.1-0-alpine build
setup.py pypi