GenoPrimer

Automated primer design for genotyping CRISPR edited cells via amplicon sequencing
GenoPrimer is described in the protoSpaceJAM preprint

Features

• Two modes: short (250 bp amplicon, MiSeq) and long (~3000 bp amplicon, PacBio)
• Automatically relaxes the criteria if no primers are found initially
• Invokes primer3 to perform thermodynamics calculation
• Use Bowtie (alternatively BLAST) to check unintended PCR products
  • Autodetects OS and use matching executables for Linux, MacOS, Windows
  • Autodetects CPU number and multi-threads Blast search ( saves 2 CPUs for the user)
• Automatically downloads and uses the human genome by default

Inputs

• A csv file containing minimumlly three columns (with the exact names), each row is a separate design:
  • ref
    The genome/build version, takes two possible values: ensemblGRCh38latest or NCBIrefseqGRCh38.p14
    
  • chr
    e.g. 2
    
  • coordinate
    Center position of the amplicon, in the form of coordinates on the chromosome, e.g. 45389323

[Helper script]

If you only have gRNA sequences but not their cutsites coordinates in the genome or the Ensemble IDs, there is a helper script "getgRNAcutsite.py" that can obtain cutsite coordinates by mapping gRNA to the genome See the usage section for more details

Outputs:

• A csv file with the input information + new columns:
  • Up to three pairs of primers for each gene/row, including Tm and expected product size.
  • A numeric number indicating how many rounds of criteria relaxation before yielding primers (column "Roundsrelaxofprimercriteria")

Automated workflow (for one site)

Usage:

clone the repository git clone https://github.com/czbiohub/GenoPrimer.git Go the repository directory, switch he branch if running branch other than master: cd GenoPrimer git checkout <branch you'd like to run>

Create conda environment conda env create -f environment.yml

You are ready to run GenoPrimer conda activate GenoPrimer python GenoPrimer.py --csv input/example.csv --type "short" Notes:
(1) During first-time run, the program will download the human genome and generate Bowtie databases
(2) In some OS, It may be required to grant permission to Bowtie executables, for example: chmod a+xX bin/bowtie-1.3.1-linux-x86_64/*

Helper script

Input: - A csv file containing minimumlly two columns (with the exact names): - "ENST" or "genename" (e.g., ENSG00000068784 or SRBD1) Note: "ENST" is preferred over "genename" - gRNAprotospacer (The sequence of the protospacer, not including the PAM, e.g., GGGCTCTCCCTGGGCGGCCA)
- ref (currently one of the two options: "ensemblGRCh38latest", "NCBIrefseqGRCh38.p14" Usage: ``` python getgRNA_cutsite.py --csv gRNA.csv ```