semibin
SemiBin: metagenomics binning with self-supervised deep learning
Science Score: 64.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
✓CITATION.cff file
Found CITATION.cff file -
✓codemeta.json file
Found codemeta.json file -
○.zenodo.json file
-
✓DOI references
Found 12 DOI reference(s) in README -
✓Academic publication links
Links to: scholar.google -
✓Committers with academic emails
1 of 6 committers (16.7%) from academic institutions -
○Institutional organization owner
-
○JOSS paper metadata
-
○Scientific vocabulary similarity
Low similarity (15.0%) to scientific vocabulary
Keywords
Repository
SemiBin: metagenomics binning with self-supervised deep learning
Basic Info
- Host: GitHub
- Owner: BigDataBiology
- Language: Python
- Default Branch: main
- Homepage: https://semibin.rtfd.io/
- Size: 106 MB
Statistics
- Stars: 134
- Watchers: 4
- Forks: 12
- Open Issues: 20
- Releases: 23
Topics
Metadata Files
README.md
SemiBin: Metagenomic Binning Using Siamese Neural Networks for short and long reads
SemiBin is a command tool for metagenomic binning with deep learning, handles both short and long reads.
CONTACT US: Please use GitHub issues for bug reports and the SemiBin users mailing-list for more open-ended discussions or questions.
If you use this software in a publication please cite:
Pan, S.; Zhu, C.; Zhao, XM.; Coelho, LP. A deep siamese neural network improves metagenome-assembled genomes in microbiome datasets across different environments. Nat Commun 13, 2326 (2022). https://doi.org/10.1038/s41467-022-29843-y
The self-supervised approach and the algorithms used for long-read datasets (as well as their benchmarking) are described in
Pan, S.; Zhao, XM; Coelho, LP. SemiBin2: self-supervised contrastive learning leads to better MAGs for short- and long-read sequencing. Bioinformatics Volume 39, Issue Supplement_1, June 2023, Pages i21–i29; https://doi.org/10.1093/bioinformatics/btad209
Basic usage of SemiBin
A tutorial of running SemiBin from scrath can be found here SemiBin tutorial.
Installation with conda:
bash
conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin
This will install both the SemiBin2 command as well (for backwards compatibility), the old SemiBin command. For new projects, it is recommended that you exclusively use SemiBin2: both commands do the same thing, but SemiBin2 has a slightly nicer interface.
The inputs to the SemiBin are contigs (assembled from the reads) and BAM files (reads mapping to the contigs). In the docs you can see how to generate the inputs starting with a metagenome.
Running with single-sample binning (for example: human gut samples):
bash
SemiBin2 single_easy_bin -i contig.fa -b S1.sorted.bam -o output --environment human_gut
(if you are using contigs from long-reads, add the --sequencing-type=long_read argument).
Running with multi-sample binning:
bash
SemiBin2 multi_easy_bin -i contig_whole.fa -b *.sorted.bam -o output
The output includes the bins in the output_bins directory (including the bin.*.fa and recluster.*.fa).
Please find more options and details below and read the docs.
Advanced Installation
SemiBin runs (and is continuously tested) on Python 3.7-3.13
pixi
The current recommended way to install SemiBin with GPU-support is to use pixi. Pixi will use the packages from conda-forge and bioconda to install SemiBin and its dependencies. See the docs for more details, but the basic idea is to create a pixi.toml file with the following content:
```toml [project] authors = ["Luis Pedro Coelho luis@luispedro.org"] channels = ["conda-forge", "bioconda"] name = "semibin_install" platforms = ["linux-64"] version = "0.1.0"
[tasks]
[dependencies] semibin = ">=2.2.0,<3" pytorch-gpu = "*"
[system-requirements] cuda = "12.0" ```
This will install SemiBin with GPU support, but it does require a CUDA-compatible GPU. Alternatively, you can install SemiBin in CPU-only mode by removing the pytorch-gpu and cuda lines.
Source
You will need the following dependencies:
The easiest way to install the dependencies is with conda:
bash
conda install -c bioconda bedtools hmmer samtools
Once the dependencies are installed, you can install SemiBin by running:
bash
pip install .
Optional extra dependencies:
Examples of binning
SemiBin runs on single-sample, co-assembly and multi-sample binning. Here we show the simple modes as an example. For the details and examples of every SemiBin subcommand, please read the docs.
Binning assemblies from long reads
Since version 1.4, SemiBin proposes new algorithm (ensemble based DBSCAN algorithm) for binning assemblies from long reads.
To use it, you can used the subcommands bin_long or pass the option --sequencing-type=long_read to the single_easy_bin or multi_easy_bin subcommands.
Easy single/co-assembly binning mode
Single sample and co-assembly are handled the same way by SemiBin.
You will need the following inputs:
- A contig file (
contig.fain the example below) - BAM file(s) from mapping short reads to the contigs, sorted (
mapped_reads.sorted.bamin the example below)
The single_easy_bin command can be used to produce results in a single step.
For example:
bash
SemiBin2 \
single_easy_bin \
--input-fasta contig.fa \
--input-bam mapped_reads.sorted.bam \
--environment human_gut \
--output output
Alternatively, you can train a new model for that sample, by not passing in the --environment flag:
bash
SemiBin2 \
single_easy_bin \
--input-fasta contig.fa \
--input-bam mapped_reads.sorted.bam \
--output output
The following environments are supported:
human_gutdog_gutoceansoilcat_guthuman_oralmouse_gutpig_gutbuilt_environmentwastewaterchicken_caecum(Contributed by Florian Plaza Oñate)global
The global environment can be used if none of the others is appropriate.
Note that training a new model can take a lot of time and disk space.
Some patience will be required.
If you have a lot of samples from the same environment, you can also train a new model from them and reuse it.
Easy multi-samples binning mode
The multi_easy_bin command can be used in multi-samples binning mode:
You will need the following inputs:
- A combined contig file
- BAM files from mapping
For every contig, format of the name is <sample_name>:<contig_name>, where
: is the default separator (it can be changed with the --separator
argument). NOTE: Make sure the sample names are unique and the separator
does not introduce confusion when splitting. For example:
```
S1:Contig1 AGATAATAAAGATAATAATA S1:Contig2 CGAATTTATCTCAAGAACAAGAAAA S1:Contig3 AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA S2:Contig1 AATGATATAATACTTAATA S2:Contig2 AAAATATTAAAGAAATAATGAAAGAAA S3:Contig1 ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG S3:Contig2 AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT S3:Contig3 CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC ```
You can use this to get the combined contig:
bash
SemiBin2 concatenate_fasta -i contig*.fa -o output
If either the sample or the contig names use the default separator (:), you will need to change it with the --separator,-s argument.
After mapping samples (individually) to the combined FASTA file, you can get the results with one line of code:
bash
SemiBin2 multi_easy_bin -i concatenated.fa -b *.sorted.bam -o output
Running with abundance information from strobealign-aemb
Strobealign-aemb is a fast abundance estimation method for metagenomic binning. As strobealign-aemb can not provide the mapping information for every position of the contig, so we can not run SemiBin2 with strobealign-aemb in binning modes where samples used smaller 5 and need to split the contigs to generate the must-link constratints.
- split the FASTA files to generate the must-link constraints
bash python script/generate_split.py -c contig.fa -o output - map reads using strobealign-aemb to generate the abundance information
bash strobealign --aemb output/split.fa read1_1.fq read1_2.fq -R 6 > sample1.txt strobealign --aemb output/split.fa read2_1.fq read2_2.fq -R 6 > sample2.txt strobealign --aemb output/split.fa read3_1.fq read3_2.fq -R 6 > sample3.txt strobealign --aemb output/split.fa read4_1.fq read4_2.fq -R 6 > sample4.txt strobealign --aemb output/split.fa read5_1.fq read5_2.fq -R 6 > sample5.txt - Running SemiBin2 (like running SemiBin with BAM files)
bash SemiBin2 generate_sequence_features_single -i contig.fa -a *.txt -o output SemiBin2 generate_sequence_features_multi -i contig.fa -a *.txt -s : -o output SemiBin2 single_easy_bin -i contig.fa -a *.txt -o output SemiBin2 multi_easy_bin i contig.fa -a *.txt -s : -o output
Output
The output folder will contain:
- Features computed from the data and used for training and clustering
- Saved semi-supervised deep learning model
- Output bins
- Table with basic information about each bin
- Some intermediate files
By default, bins are in output_bins directory.
For more details about the output, read the docs.
Owner
- Name: Big Data Biology Lab
- Login: BigDataBiology
- Kind: organization
- Email: luis@luispedro.org
- Repositories: 15
- Profile: https://github.com/BigDataBiology
Citation (CITATION.md)
If you use this software in a publication please cite: > Pan, S.; Zhu, C.; Zhao, XM.; Coelho, LP. A deep siamese neural network > improves metagenome-assembled genomes in microbiome datasets across > different environments. *Nat Commun* **13,** 2326 (2022). > https://doi.org/10.1038/s41467-022-29843-y And > Pan, S., Zhao, XM; Coelho, LP. SemiBin2: Self-Supervised Contrastive Learning > Leads to Better MAGs for Short- and Long-Read Sequencing. Bioinformatics 39 > (39 Suppl 1): i21–29. https://doi.org/10.1038/s41467-022-29843-y
GitHub Events
Total
- Create event: 2
- Release event: 1
- Issues event: 42
- Watch event: 22
- Issue comment event: 65
- Push event: 24
- Pull request event: 2
- Fork event: 1
Last Year
- Create event: 2
- Release event: 1
- Issues event: 42
- Watch event: 22
- Issue comment event: 65
- Push event: 24
- Pull request event: 2
- Fork event: 1
Committers
Last synced: over 1 year ago
Top Committers
| Name | Commits | |
|---|---|---|
| Luis Pedro Coelho | l****s@l****g | 292 |
| psj1997 | 1****9@q****m | 268 |
| SvetlanaUP | 6****P | 10 |
| Yang Yunyi | y****g@l****k | 2 |
| Florian Plaza Oñate | f****e@i****r | 1 |
| Sebastian Jaenicke | s****k@C****E | 1 |
Committer Domains (Top 20 + Academic)
Issues and Pull Requests
Last synced: 7 months ago
All Time
- Total issues: 126
- Total pull requests: 39
- Average time to close issues: 2 months
- Average time to close pull requests: 3 days
- Total issue authors: 78
- Total pull request authors: 7
- Average comments per issue: 3.19
- Average comments per pull request: 0.46
- Merged pull requests: 31
- Bot issues: 0
- Bot pull requests: 0
Past Year
- Issues: 24
- Pull requests: 2
- Average time to close issues: about 1 month
- Average time to close pull requests: less than a minute
- Issue authors: 17
- Pull request authors: 1
- Average comments per issue: 1.0
- Average comments per pull request: 0.0
- Merged pull requests: 0
- Bot issues: 0
- Bot pull requests: 0
Top Authors
Issue Authors
- luispedro (12)
- fplaza (7)
- SilasK (5)
- Louis-MG (3)
- guangingmai (3)
- FelipeMSD (3)
- adityabandla (3)
- LanSabb (2)
- SvetlanaUP (2)
- yazhinia (2)
- ZarulHanifah (2)
- PeterCx (2)
- B-1991-ing (2)
- nashanghenzan (2)
- rhysnewell (2)
Pull Request Authors
- SvetlanaUP (14)
- luispedro (14)
- psj1997 (6)
- SebastianDall (2)
- alienzj (2)
- fplaza (1)
- sjaenick (1)
Top Labels
Issue Labels
Pull Request Labels
Packages
- Total packages: 1
-
Total downloads:
- pypi 124 last-month
- Total dependent packages: 0
- Total dependent repositories: 1
- Total versions: 23
- Total maintainers: 1
pypi.org: semibin
Metagenomic binning with siamese neural networks
- Documentation: https://semibin.readthedocs.io/
- License: MIT
-
Latest release: 2.2.0
published about 1 year ago
Rankings
Maintainers (1)
Dependencies
- mkdocs >=1.3.0
- atomicwrites *
- numexpr *
- numpy *
- pandas *
- python-igraph *
- pyyaml *
- requests *
- scikit-learn *
- torch *
- tqdm *
- actions/checkout v2 composite
- actions/setup-python v2 composite
- conda-incubator/setup-miniconda v2 composite