stampa

Sequence Taxonomic Assignment by Massive Pairwise Alignments

https://github.com/frederic-mahe/stampa

Science Score: 67.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
    Found CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
    Found 1 DOI reference(s) in README
  • Academic publication links
    Links to: ncbi.nlm.nih.gov, wiley.com
  • Academic email domains
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (8.1%) to scientific vocabulary
Last synced: 6 months ago · JSON representation ·

Repository

Sequence Taxonomic Assignment by Massive Pairwise Alignments

Basic Info
  • Host: GitHub
  • Owner: frederic-mahe
  • License: gpl-3.0
  • Language: Shell
  • Default Branch: master
  • Size: 73.2 KB
Statistics
  • Stars: 14
  • Watchers: 6
  • Forks: 3
  • Open Issues: 0
  • Releases: 0
Created almost 11 years ago · Last pushed over 2 years ago
Metadata Files
Readme License Citation

README.md

stampa

Sequence Taxonomic Assignment by Massive Pairwise Alignments

The purpose of stampa is to assign amplicons from environmental studies to known taxonomic groups. It is based on vsearch for the actual similarity search and pairwise comparisons, the rest of the scripts only deal with the splitting of the input and gathering of the output (similar in spirit to a map-reduce approach).

Outline: * check the input fasta file, * create and work in a sub-directory, * split it in smaller chunks, * for each chunk, launch a vsearch job (LSF scheduler), * collect all the results, * solve ties by computing last common ancestor assignments, * output a table of taxonomic assignments.

The stampa scripts are made public for transparency. These scripts are not generic and are very unlikely to run out-of-the-box in a new environment (see for instance #issue 1). However, experience has shown that with a reasonable amount of modifications (and patience), stampa can be successfully replicated.

Requirements

Input

stampa expects the input fasta file to look like that:

```

4cd8428ea6c4e43cea1e82374c94a8e815638316 gtcgctactaccgattgaacgttttagtgaggtcctcggactgtttggtagtcggatcactctgactgcctggcgggaagacgaccaaactgtagcgtttagaggaagtaaaagtcgtaacaaggtttcc 43fc0f0172e7aaac61d17259daa5beb413556476 gtcgctactaccgattgaacgttttagtgaggtcctcggactgtttgcctggcggattactctgcctggctggcgggaagacgaccaaactgtagcgtttagaggaagtaaaagtcgtaacaaggtttcc 97485665bcded44c4d86c131ca7148487929938 gtcgctcctaccgattgaatacgttggtgattgaattggataaagagatatcatcttaaatgatagcaaagcggtaaacatttgtaaactagattatttagaggaaggagaagtcgtaacaaggtttcc e16f63411f69ad864bd504118029a3447174749 gtcgctactaccgattgaacgttttagtgaggtatttggactgggccttgggaggattcgttctcccatgttgctcgggaagactcccaaacttgagcgtttagaggaagtaaaagtcgtaacaaggtttcc 8120906e4f554b6d4fa5f41604d985fd_6704338 gtcgctactaccgattgaacgttttagtgaggtcctcggactgtgatcctggctggttactcagcctgggttgcgggaagacgaccaaactgtagcgtttagaggaagtaaaagtcgtaacaaggtttcc ```

Abundance values (after the _) will be reported in the results. Abundance annotations in uclust-style ;size= are also accepted.

References

Reference datasets need to be cut using the same primers than the one used to produce the amplicons. The reference sequences should be formatted as such ">accession[space]taxonomy":

```

AM490275.1.2082U Eukaryota|Opisthokonta|Metazoa|Arthropoda|Crustacea|Branchiopoda|Bosmina|Bosmina+longirostris gtcgctactaccgattgaatgatttagtgagaacttcagacggctatgtttgtccggggcaacccgcgtcaagcagggctgaaagatgttcaaacttgatcctttagaggaagtaaaagtcgtaacaaggtttcc AY772728.1.1784U Eukaryota|Archaeplastida|Rhodophyta|Florideophyceae|Gigartinales|GigartinalesX|Atractophora|Atractophora+hypnoides gtcgctcctaccgattgagtggtccggtgaggccttgggagggcaggatggactgttgcttgtcgacggaccgtctggcccaaacttggtcaaaccttatcacttagaggaaggagaactcgtaacaaggtttcc JN701622.1.846U Eukaryota|Opisthokonta|Metazoa|Arthropoda|Crustacea|Malacostraca|Biarctus|Biarctus+sordidus gtcgctactaccgattgaatgatttagtgaggccttcggactggcgctcttggatgttctacccttcacgctgcatccgtggcgtaggggttctcgcctcgagctgacggaaagatgtccaaacttgatcatttagaggaagtaaaagtcgtaacaaggtttcc ```

The space separating the accession field and the taxonomic path is important. The field separator | (pipe) for the taxonomic levels is important too. The number of taxonomic levels, using DNA or RNA, or the case of the DNA sequence are not important.

Here is how I trim and format the PR2 database using the primers published by Stoeck et al. (2010):

```sh

download the UTAX version and extract the V4 region

VERSION="4.10.0" URL="https://github.com/vaulot/pr2database/releases/download" SOURCE="pr2version${VERSION}UTAX.fasta" wget "${URL}/${VERSION}/${SOURCE}.gz" gunzip -k ${SOURCE}.gz

PRIMERF="CCAGCASCYGCGGTAATTCC" PRIMERR="TYRATCAAGAACGAAAGT" OUTPUT="${SOURCE/UTAX*/}${PRIMERF}${PRIMERR}.fas" LOG="${OUTPUT/.fas/.log}" MINLENGTH=32 MINF=$(( ${#PRIMERF} * 2 / 3 )) MINR=$(( ${#PRIMERR} * 2 / 3 )) CUTADAPT="$(which cutadapt) --discard-untrimmed --minimum-length ${MIN_LENGTH}"

dos2unix < "${SOURCE}" | \ sed '/^>/ s/;tax=k:/ / /^>/ s/,[dpcofgs]:/|/g /^>/ ! s/U/T/g' | \ ${CUTADAPT} -g "${PRIMERF}" -O "${MINF}" - 2> "${LOG}" | \ ${CUTADAPT} -a "${PRIMERR}" -O "${MINR}" - 2>> "${LOG}" > "${OUTPUT}" ```

Here is how I trim and format the SILVA rRNA database using the primers published by Parada et al. (2016):

```sh RELEASE=132 URL="https://www.arb-silva.de/fileadmin/silvadatabases/release${RELEASE}/Exports" INPUT="SILVA${RELEASE}SSURefNr99tax_silva.fasta.gz"

Download and check

wget -c ${URL}/${INPUT}{,.md5} && md5sum -c ${INPUT}.md5

Define variables and output files

OUTPUT="${INPUT/.fasta.gz/515F926R.fasta}" LOG="${INPUT/.fasta.gz/515F926R.log}" PRIMERF="GTGYCAGCMGCCGCGGTAA" PRIMERR="CCGYCAATTYMTTTRAGTTT" ANTIPRIMERR="AAACTYAAAKRAATTGRCGG" MINLENGTH=32 MINF=$(( ${#PRIMERF} * 2 / 3 )) MINR=$(( ${#PRIMERR} * 2 / 3 )) CUTADAPT="cutadapt --discard-untrimmed --minimum-length ${MINLENGTH}"

Trim forward & reverse primers, format

zcat "${INPUT}" | sed '/^>/ ! s/U/T/g' | \ ${CUTADAPT} -g "${PRIMERF}" -O "${MINF}" - 2> "${LOG}" | \ ${CUTADAPT} -a "${ANTIPRIMERR}" -O "${MINR}" - 2>> "${LOG}" | \ sed '/^>/ s/;/|/g ; /^>/ s/ //g ; /^>/ s/_/ /1' > "${OUTPUT}" ```

And here is how I trim and format the BoLD Cytochrome oxidase subunit 1 (COI) database using the mlCOIintF-HCO2198 primers:

```sh

Define variables and output file

URL="http://www.barcodinglife.org/data/datarelease/NewPackages" VERSION="6.50" TARGET="iBOLphase${VERSION}COI.tsv.zip" INPUT=${TARGET/.zip/} PRIMERF="GGWACWGGWTGAACWGTWTAYCCYCC" PRIMERR="TGATTTTTTGGTCACCCTGAAGTTTA" PRIMERNAMES="mlCOIintFHCO2198" FINALFASTA="bold${PRIMERNAMES}${VERSION}.fasta" LOG=${FINALFASTA/.fasta/.log} CUTADAPT=$(which cutadapt)

Download and clean

[[ -f ${TARGET} ]] || wget ${URL}/${TARGET} [[ -e ${INPUT} ]] || unzip ${TARGET}

Prepare fasta file, modify headers and trim primers

awk 'BEGIN {FS = "\t"} {if (NR > 1) { print ">"$5"@"$9"|"$10"|"$11"|"$12"|"$13"|"$14"|"$15"\n"$31 } }' ${INPUT} | \ sed -r 's/||/|missing|/g s/ [:[:alnum:]]+$// s/||/|missing|/ s/ // ; s/@/ /' | \ ${CUTADAPT} --discard-untrimmed -g "${PRIMERF}" - 2> "${LOG}" | \ ${CUTADAPT} -a "${PRIMERR}" - 2>> "${LOG}" > "${FINALFASTA}" ```

Third-party tools

stampa was tested with: * python 3.5 (or later versions), * vsearch 1.1.13 (or later versions), * bash 4 (or later versions), * (probably other hidden dependencies)

Results

stampa will output a table containing 5 fields: * identifier of the environmental sequence, * abundance of the environmental sequence, * global pairwise identity with reference sequences (from 0.0% to 100.0%), * taxonomic assignment (could be last common ancestor), * accession numbers of reference sequences (co-best hits, comma separated)

4cd8428ea6c4e43cea1e82374c94a8e8 18416272 96.9 Eukaryota|Opisthokonta|Metazoa|Arthropoda|Crustacea|Maxillopoda|Copepoda|Calanoida|Gaetanus|Gaetanus+variabilis AB625960.1.2064_U 43fc0f0172e7aaac61d17259daa5beb4 18024962 100.0 Eukaryota|Opisthokonta|Metazoa|Arthropoda|Crustacea|Maxillopoda|Copepoda|Calanoida|*|* L81939.1.1800_U,AF514342.1.1802_U,AF514341.1.1802_U,AF514343.1.1802_U,AF514340.1.1802_U,AF514344.1.1802_U,AF514339.1.1802_U 3f7e7831cc058f87f68b06d7a4f1762f 15107744 100.0 Eukaryota|Alveolata|Dinophyta|Dinophyceae|*|*|*|*|* AF274260,EF492510,EF492511,EU287485,EU287487,EU780638,AY803739,DQ004735,Y16232,AJ415519,EF492484,HM067010,JF791096

The third line shows what happens when there is a problem with the reference database. Several identical references are assigned to different branches of the Dinophyceae, logically stampa assigned the sequence to the last common ancestor (taxa names were replaced by a star *).

Stampa plots

Building on taxonomic assignment results, it is straightforward to produce "stampa plots". These informative plots represent the distribution of maximum percentage of similarity to reference sequences. Ideally, most environmental sequences should be close to known references and stand on the right side of the plot (close to 100% similarity).

Stampa plots are graphical evaluations of the coverage of environmental sequences by reference sequences, allowing to assess immediately the numerical importance of novel sequences.

The first step is to summarize stampa results: target a specific taxa (Metazoa fo instance), group by similarity value (column #3) and count reads (column #2):

```sh TABLE="18Ssamplesstampa.table"

grep "Metazoa" "${TABLE}" | \ awk 'BEGIN {FS = "\t"} {stampa[$3] += $2} END {for (similarity in stampa) { print similarity, stampa[similarity] }}' | sort -k1,1n > "${TABLE/.table/.data}" ```

Then, use the data to produce a plot with R and ggplot (the above step can be easily performed in R with the packages tidyr and dplyr, if you are more familiar with them):

```R library(ggplot2) library(scales)

setwd("~/mydata/") input <- "18Ssamplesstampa.data" TITLE <- "Metazoa"

Load the data

d <- read.table(input, sep = " ", dec = ".") colnames(d) <- c("identities", "abundance") d$identities <- d$identities / 100

Get the max abundance value

y_max <- max(d$abundance)

Plot

ggplot(d, aes(x = identities, y = abundance)) + geomsegment(aes(xend = identities, yend = 0), colour = "darkred", size = 1) + scalexcontinuous(labels = percent, limits = c(0.5, 1)) + scaleycontinuous(labels = comma) + xlab("max % of similarity to reference database") + ylab("number of reads") + annotate("text", x = 0.50, y = ymax * 0.9, hjust = 0, colour = "grey", size = 8, label = TITLE)

Output to PDF

output <- gsub(".data", ".pdf", input, fixed = TRUE) ggsave(file = output, width = 8 , height = 5)

quit(save = "no") ```

Here an example of stampa plot computed from the publically available TARA dataset (marine diversity of unicellular eukaryotes):

Most environmental sequences are close to known references, with the exception of a few interesting peaks around 83-85% similarity. Stampa plots indicate where database curation efforts or additional biological observations are needed the most.

Owner

  • Name: Frédéric Mahé
  • Login: frederic-mahe
  • Kind: user
  • Location: Montpellier, France
  • Company: Cirad

bioinformatician

Citation (CITATION.cff)

cff-version: 1.2.0
message: "If you use this software, please cite it as below."
authors:
- family-names: "Mahé"
  given-names: "Frédéric"
  orcid: "https://orcid.org/0000-0002-2808-0984"
title: "stampa: sequence taxonomic assignment using massive pairwise alignments"
version: 2.0.0
date-released: 2019-09-21
url: "https://github.com/frederic-mahe/stampa"

GitHub Events

Total
Last Year