Data

Tools

Indexes

Applications

Experiments

Open Source Science

pyviko

A web interface & Python tool to design knockouts in viruses with overlapping genes.

https://github.com/louiejtaylor/pyviko

Science Score: 77.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • ✓
    CITATION.cff file
    Found CITATION.cff file
  • ✓
    codemeta.json file
    Found codemeta.json file
  • ✓
    .zenodo.json file
    Found .zenodo.json file
  • ✓
    DOI references
    Found 1 DOI reference(s) in README
  • ✓
    Academic publication links
    Links to: ncbi.nlm.nih.gov
  • ✓
    Committers with academic emails
    1 of 4 committers (25.0%) from academic institutions
  • ○
    Institutional organization owner
  • ○
    JOSS paper metadata
  • ○
    Scientific vocabulary similarity
    Low similarity (10.4%) to scientific vocabulary
Last synced: 6 months ago · JSON representation ·

Repository

A web interface & Python tool to design knockouts in viruses with overlapping genes.

Basic Info
Statistics
  • Stars: 3
  • Watchers: 1
  • Forks: 0
  • Open Issues: 1
  • Releases: 0
Created almost 11 years ago · Last pushed 7 months ago
Metadata Files
Readme License Citation

README.md

pyViKO

A Python tool to generate viral knockouts.

What is Pyviko?

pyviko stands for Python viral knockouts. pyviko is a tool for designing molecular cloning protocols in complex viruses or other organisms with overlapping genes. Our manuscript has details and worked examples: Taylor LJ, Strebel K. Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes. BMC Microbiol. 2017 Jan 7;17(1):12..

What is an “overprinted gene”?

An overprinted gene is defined as the extension of one gene's open reading frame into the reading frame of a second gene. A single DNA sequence can code for multiple proteins in different reading frames or by reading in different directions. For more information, see the Wikipedia article on reading frames or this (open access) paper on origins of overprinted genes.

How do I install Pyviko?

Using the python package manager:

pip install pyviko

Otherwise, you can install it directly using setup.py:

python `setup.py` install

(What is setup.py?)

Web interface

The basic workflow is available as a web-based JavaScript user interface. See the Quick-start guide (pdf) for more information on using the web interface.

How do I use Pyviko?

Here's a simple example:

>>> from pyviko import mutation
>>> m = mutation.Mutant(        "ATGCATCCCTCAAGTGACTAA")
>>> m.set_over_gene(over_seq = "ATGTATGCATCCCTCAAGTGA")
>>> m.find_mutants()
[(0, 'ACG'), (3, 'TAA'), (3, 'TGA')]

Sample scripts and scripts used in the manuscript can be found in scripts/. Documentation for pyviko is also available.

Owner

  • Name: Louis J Taylor
  • Login: louiejtaylor
  • Kind: user

Hunting viruses at the University of Pennsylvania.

Citation (CITATION.cff) 

cff-version: 1.0.3
message: If you use this software, please cite it as below.
references:
  - type: article
  authors:
    - family-names: Taylor
      given-names: Louis J
      orcid: https://orcid.org/0000-0002-6993-5838
    - family-names: Strebel
      given-names: Klaus
  title: "Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes"
  journal: BMC Microbiology
  doi: 10.1186/s12866-016-0920-3
  year: 2017

GitHub Events

Total
  • Push event: 41
Last Year
  • Push event: 41

Committers

Last synced: almost 3 years ago

All Time
  • Total Commits: 153
  • Total Committers: 4
  • Avg Commits per committer: 38.25
  • Development Distribution Score (DDS): 0.32
Top Committers
Name Email Commits
Louis Taylor l****r@g****m 104
Louis J Taylor l****r@u****m 37
louiejtaylor l****r@g****m 9
Jonah Haber h****b@c****v 3
Committer Domains (Top 20 + Academic)
cbbdev11.be-md.ncbi.nlm.nih.gov: 1

Issues and Pull Requests

Last synced: 7 months ago

All Time
  • Total issues: 2
  • Total pull requests: 3
  • Average time to close issues: 5 months
  • Average time to close pull requests: less than a minute
  • Total issue authors: 2
  • Total pull request authors: 1
  • Average comments per issue: 1.5
  • Average comments per pull request: 0.0
  • Merged pull requests: 3
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 0
  • Pull requests: 0
  • Average time to close issues: N/A
  • Average time to close pull requests: N/A
  • Issue authors: 0
  • Pull request authors: 0
  • Average comments per issue: 0
  • Average comments per pull request: 0
  • Merged pull requests: 0
  • Bot issues: 0
  • Bot pull requests: 0
View more stats
Top Authors
Issue Authors
  • jrr-cpt (1)
  • louiejtaylor (1)
Pull Request Authors
  • louiejtaylor (3)
Top Labels
Issue Labels
Pull Request Labels

Dependencies

setup.py pypi
  • future *