https://github.com/gagolews/clustering-data-v0

Datasets for Clustering [DEPRECATED – A NEW VERSION IS AVAILABLE]

https://github.com/gagolews/clustering-data-v0

Science Score: 26.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
  • DOI references
    Found 4 DOI reference(s) in README
  • Academic publication links
  • Academic email domains
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (9.7%) to scientific vocabulary

Keywords

clustering data dataset machine-learning
Last synced: 5 months ago · JSON representation

Repository

Datasets for Clustering [DEPRECATED – A NEW VERSION IS AVAILABLE]

Basic Info
Statistics
  • Stars: 0
  • Watchers: 2
  • Forks: 0
  • Open Issues: 0
  • Releases: 0
Topics
clustering data dataset machine-learning
Created over 4 years ago · Last pushed over 3 years ago
Metadata Files
Readme

README.md

A Benchmark Suite for Clustering Algorithms - Version 0 [DEPRECATED]

Important Note

This list has been superseded by the Framework for Benchmarking Clustering Algorithms!

General Remarks

If used in publications (as a whole), please cite this dataset battery as: Gagolewski M., Bartoszuk M., Cena A., Genie: A new, fast, and outlier-resistant hierarchical clustering algorithm, Information Sciences 363, 2016, pp. 8-23, doi:10.1016/j.ins.2016.05.003.

In each case, there is a data text file, storing an n * d matrix (n observations in a d dimensional space), and the corresponding labels file which consists of n labels being integers from the set 1,…,k, where k is the number of underlying clusters.

Datasets

MNIST Handwritten Digits (images)

Download files:

  • digits70kpixels.data.gz (15 MB), digits70kpixels.labels.gz (37 kB), n=70000, d=784, k=10,
  • digits2kpixels.data.gz (440 kB), digits2kpixels.labels.gz (1 kB), n=2000, d=784, k=10.

This data come from The MNIST database of handwritten digits by Yann LeCun, Corinna Cortes, and Christopher J.C. Burges. The dataset was originally released in form of binary files.

digits70k_pixels consists of 70000 of 28x28 pixel images from the MNIST database, in order of appearance: 30000 SD-3 training patterns, 30000 SD-1 training patterns, 5000 SD-3 test patterns, and 5000 SD-1 test patterns. Moreover, digits2k_pixels gives first 2000 objects from digits70k_pixels.

To import the dataset in Python, execute:

```python import numpy as np data = np.loadtxt("digits2kpixels.data.gz", ndmin=2)/255.0 data.shape = (data.shape[0], int(np.sqrt(data.shape[1])), int(np.sqrt(data.shape[1]))) labels = np.loadtxt("digits2kpixels.labels.gz", dtype='int')

display:

import matplotlib.pyplot as plt i = 122 print(labels[i]) plt.imshow(data[i,:,:], cmap=plt.get_cmap("gray")) plt.show() ```

To do the same in R, write:

```r data <- as.matrix(read.table(gzfile("digits2kpixels.data.gz")))/255 dim(data) <- c(nrow(data), 28, 28) labels <- scan(gzfile("digits2kpixels.labels.gz"), quiet=TRUE)

draw:

i <- 123 par(mar=rep(0,4)) image(data[i,,], asp=1, col=gray.colors(256), ylim=c(1,0), axes=FALSE) ```

Distribution of labels:

```

0 1 2 3 4 5 6 7 8 9

digits2k_pixels 191 220 198 191 214 180 200 224 172 210

digits70k_pixels 6903 7877 6990 7141 6824 6313 6876 7293 6825 6958

```

MNIST Handwritten Digits (point sets)

Download files:

  • digits70kpoints.data.gz (18 MB), digits70kpoints.labels.gz (37 kB), n=70000, d=2, k=10,
  • digits2kpoints.data.gz (555 kB), digits2kpoints.labels.gz (1 kB), n=2000, d=2, k=10.

Based on the aforementioned dataset, we can represent each digit as a set of points in R². Brightness cutoff of 0.75 was used to generate the data. Each digit was shifted and scaled.

Warning. The dataset consists of 3 columns. The 1st column indicates to which digit (one of 70000 or 2000) a point with x and y coordinates given by the 2nd and the 3rd column, respectively, belongs to. Therefore, the dataset must be preprocessed before use.

To do so in R, execute:

```r data <- as.matrix(read.table(gzfile("digits2k_points.data.gz"))) data <- lapply(split(data[,-1], data[,1]), function(digit) matrix(digit, ncol=2))

now data is a list of 2-column matrices

labels <- scan(gzfile("digits2k_points.labels.gz"), quiet=TRUE)

draw:

i <- 123 par(mar=rep(0,4)) plot(data[[i]][,1], data[[i]][,2], asp=1, axes=FALSE, ann=FALSE, pch=16) ```

Equivalent Python code:

```python import numpy as np data = np.loadtxt("digits2kpoints.data.gz", ndmin=2) labels = np.loadtxt("digits2kpixels.labels.gz", dtype='int') brk, = np.nonzero(np.diff(data[:,0])) data = np.array_split(data[:,1:], brk+1, 0)

draw:

import matplotlib.pyplot as plt i = 122 fig = plt.figure() fig.add_subplot(111, aspect='equal') plt.scatter(data[i][:,0], data[i][:,1]) plt.show() ```

Label distribution:

```

0 1 2 3 4 5 6 7 8 9

digits2k_points 191 220 198 191 214 180 200 224 172 210

digits70k_points 6903 7877 6990 7141 6824 6313 6876 7293 6825 6958

```

In this case, try playing with the Hausdorff (e.g., Euclidean-based) distance, see hausdorff.cpp for a few auxiliary Rcpp routines.

Iris(es)

Download files:

  • iris.data.gz (681 B), iris.labels.gz (31 B), n=150, d=4, k=3,
  • iris5.data.gz (520 B), iris5.labels.gz (30 B), n=105, d=4, k=3.

This is the famous Fisher’s iris dataset, available in the R datasets package. iris5 is an imbalanced version in which we take only 5 last observations from the 1st group (iris setosa).

Distribution of labels:

```

1 2 3

iris 50 50 50

iris5 5 50 50

```

SIPU Benchmark Data

Prof. P. Fränti and his colleagues form the University of Eastern Finland prepared a list of example benchmarks, which is available here. As some of the datasets come with no labels, we make them available here in a concise format. We chose only the datasets of sizes <= 10000 and such that some of the hierarchical clustering algorithms had problems with correctly guessing the proper labels.

S-sets

Download files:

  • s1.data.gz (34 kB), s1.labels.gz (83 B), n=5000, d=2, k=15
  • s2.data.gz (35 kB), s2.labels.gz (83 B), n=5000, d=2, k=15
  • s3.data.gz (35 kB), s3.labels.gz (83 B), n=5000, d=2, k=15
  • s4.data.gz (35 kB), s4.labels.gz (83 B), n=5000, d=2, k=15

Source: P. Fränti, O. Virmajoki, Iterative shrinking method for clustering problems, Pattern Recognition, 39(5), 2006, pp. 761-765.

Distribution of labels:

```

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

s1 300 316 314 318 325 326 334 338 341 342 347 349 350 350 350

s2 300 317 315 320 321 329 334 333 340 345 346 350 350 350 350

s3 300 321 316 323 322 331 333 337 334 337 346 350 350 350 350

s4 300 316 327 320 323 324 327 336 337 344 347 350 349 350 350

```

A-sets

Download files:

  • a1.data.gz (17 kB), a1.labels.gz (82 B), n=3000, d=2, k=20
  • a2.data.gz (29 kB), a2.labels.gz (112 B), n=5250, d=2, k=35
  • a3.data.gz (41 kB), a3.labels.gz (144 B), n=7500, d=2, k=50

Source: I. Kärkkäinen, P. Fränti, Dynamic local search algorithm for the clustering problem, Research Report A-2002-6.

Distribution of labels: Classes are fully balanced.

G2-sets

Download files:

  • g2-2-100.data.gz (7 kB), g2-2-100.labels.gz (43 B), n=2048, d=2, k=2
  • g2-16-100.data.gz (52 kB), g2-16-100.labels.gz (43 B), n=2048, d=16, k=2
  • g2-64-100.data.gz (200 kB), g2-64-100.labels.gz (43 B), n=2048, d=64, k=2

Gaussian clusters of varying dimensions, high variance.

Distribution of labels: Classes are fully balanced.

Other

Download files:

  • unbalance.data.gz (37 kB), unbalance.labels.gz (65 B), n=6500, d=2, k=8
  • Aggregation.data.gz (3 kB), Aggregation.labels.gz (48 B), n=788, d=2, k=7
  • Compound.data.gz (1 kB), Compound.labels.gz (43 B), n=399, d=2, k=6
  • pathbased.data.gz (1 kB), pathbased.labels.gz (36 B), n=300, d=2, k=3
  • spiral.data.gz (1 kB), spiral.labels.gz (31 B), n=312, d=2, k=3
  • D31.data.gz (20 kB), D31.labels.gz (97 B), n=3100, d=2, k=31
  • R15.data.gz (3 kB), R15.labels.gz (63 B), n=600, d=2, k=15
  • flame.data.gz (878 B), flame.labels.gz (35 B), n=240, d=2, k=2
  • jain.data.gz (1 kB), jain.labels.gz (31 B), n=373, d=2, k=2

Sources:

  • A. Gionis, H. Mannila, P. Tsaparas, Clustering aggregation, ACM Transactions on Knowledge Discovery from Data (TKDD), 2007, pp. 1-30.
  • C.T. Zahn, Graph-theoretical methods for detecting and describing gestalt clusters, IEEE Transactions on Computers C-20(1), 1971, pp. 68-86.
  • H. Chang, D.Y. Yeung, Robust path-based spectral clustering, Pattern Recognition 41(1), 2008, pp. 191-203.
  • C.J. Veenman, M.J.T. Reinders, E. Backer, A maximum variance cluster algorithm, IEEE Transactions on Pattern Analysis and Machine Intelligence 24(9), 2002, pp. 1273-1280.
  • A. Jain, M. Law, Data clustering: A user’s dilemma, Lecture Notes in Computer Science 3776, 2005, pp. 1-10.
  • L. Fu, E. Medico, FLAME, a novel fuzzy clustering method for the analysis of DNA microarray data, BMC bioinformatics 8, 2007, p. 3.

Label distributions:

```

1 2 3 4 5 6 7 8

unbalance 2000 2000 2000 100 100 100 100 100

1 2 3 4 5 6 7

Aggregation 45 170 102 273 34 130 34

1 2 3 4 5 6

Compound 50 92 38 45 158 16

1 2 3

pathbased 110 97 93

1 2 3

spiral 101 105 106

D31 balanced

R15 balanced

1 2

flame 87 153

1 2

jain 276 97

```

Character Strings

ACTG Sequences

Download files:

  • actg1.data.gz (77 kB), actg1.labels.gz (2 kB), n=2500, mean d=99.9, k=20
  • actg2.data.gz (149 kB), actg2.labels.gz (1 kB), n=2500, mean d=199.9, k=5
  • actg3.data.gz (187 kB), actg3.labels.gz (1 kB), n=2500, mean d=250.2, k=10

The datasets consist of character strings (of varying lengths) over the {a,c,t,g} alphabet. First, k random strings (of identical lengths) were generated for the purpose of being cluster centres. Each string in the dataset was created by selecting a random cluster centre and then performing many Levenshtein edit operations (character insertions, deletions, substitutions) at randomly chosen positions.

Preferably for use with the Levenshtein distance.

```r library("stringi") data <- readLines(gzfile("actg1.data.gz")) labels <- scan(gzfile("actg1.labels.gz"), quiet=TRUE)

five observations in the 1st group:

cat(data[labels==1][1:5], sep='\n')

ctttctgtgctcgcgagctaaacgtgtgtaggcccttgtactacaaccaactgctagaatagtgacgcccctttgcctggcgcgccgctacttttagcgggcatgacg

ctttgatgtgctgaataatctcagggctgtgtactacatcaagtccaccactactagttggcgaccgctttcctagagacagcgcaagcattcacatacg

ccaccttatgctgcatgaacgggcggattggatctacaaccgcaattgctagaattcgcctcctttggacaattacgtgctacttaaagcgcctcg

cacttcatgaacggataccgatgtggggcatttgtactactccgaacactagcgattcgaccgcgttttctggacaacgccaagactgttttaacgtcaga

cctagtgcacgtgacacactggtgtggctgggtaacgtcccacaacacctgctagaatcgacccgcacttaggaacagcaagtactgttaagcgcattct

```

Label distributions:

```

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

actg1 137 121 133 132 123 124 131 111 118 120 122 139 142 123 124 116 122 124 124 114

1 2 3 4 5

actg2 50 246 571 783 850

1 2 3 4 5 6 7 8 9 10

actg3 50 181 390 487 501 384 267 132 65 43

```

Binary Sequences

Download files:

  • binstr1.data.gz (44 kB), binstr1.labels.gz (2 kB), n=2500, d=100, k=25
  • binstr2.data.gz (85 kB), binstr2.labels.gz (1 kB), n=2500, d=200, k=5
  • binstr3.data.gz (105 kB), binstr3.labels.gz (1 kB), n=2500, d=250, k=10

Datasets consist of character strings (each of the same length d) over the {0,1} alphabet. First, k random strings were generated for the purpose of being cluster centres. Each string in the dataset was created by selecting a random cluster centre and then modifying digits at randomly chosen positions.

Preferably for use with the Hamming distance.

```r library("stringi") data <- readLines(gzfile("binstr1.data.gz")) labels <- scan(gzfile("binstr1.labels.gz"), quiet=TRUE)

1st cluster median (w.r.t. the Hamming distance)

mode <- function(x) { t <- table(x); names(t)[which.max(t)] } cat(striflatten(apply(do.call(rbind, strisplit_boundaries(data[labels==1], type="character")), 2, mode)))

0101101110101101000111111111001111001000000000000100101001101000101110111000010001010011100101001001

five observations in the 1st group:

cat("\n", data[labels==1][1:5], sep='\n')

0101001000111001001011111110001111101100100000101100101000100000111110111011000001111010000101101011

0011101010111001000011100001101111010000000111001100100001111001110110101000000000010001110001001100

0010100100100101000111001110011111001000110001000110011001101011100110111100010001110111100101001001

0101001001000001000011001001001111000011000010010101111100101110101110111010000001000011000101001001

1101001001001100010111011111011001111000001100000100001001101000000010111000110001010011110110000001

```

Label distributions:

```

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

binstr1 97 112 112 101 104 91 106 88 105 104 86 95 113 107 76 101 110 105 98 90 76 108 91 111 113

1 2 3 4 5

binstr2 51 267 540 756 886

1 2 3 4 5 6 7 8 9 10

binstr3 12 90 220 332 467 446 381 277 175 100

```

Other

For more benchmark data, see:

Owner

  • Name: Marek Gagolewski
  • Login: gagolews
  • Kind: user
  • Location: Melbourne, VIC, Australia
  • Company: Deakin University

Free universities!

GitHub Events

Total
Last Year

Issues and Pull Requests

Last synced: 9 months ago

All Time
  • Total issues: 0
  • Total pull requests: 0
  • Average time to close issues: N/A
  • Average time to close pull requests: N/A
  • Total issue authors: 0
  • Total pull request authors: 0
  • Average comments per issue: 0
  • Average comments per pull request: 0
  • Merged pull requests: 0
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 0
  • Pull requests: 0
  • Average time to close issues: N/A
  • Average time to close pull requests: N/A
  • Issue authors: 0
  • Pull request authors: 0
  • Average comments per issue: 0
  • Average comments per pull request: 0
  • Merged pull requests: 0
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
Pull Request Authors
Top Labels
Issue Labels
Pull Request Labels