trviz
A python library for decomposing and visualizing tandem repeat sequences
Science Score: 67.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
✓CITATION.cff file
Found CITATION.cff file -
✓codemeta.json file
Found codemeta.json file -
✓.zenodo.json file
Found .zenodo.json file -
✓DOI references
Found 2 DOI reference(s) in README -
○Academic publication links
-
✓Committers with academic emails
1 of 2 committers (50.0%) from academic institutions -
○Institutional organization owner
-
○JOSS paper metadata
-
○Scientific vocabulary similarity
Low similarity (13.4%) to scientific vocabulary
Keywords
Repository
A python library for decomposing and visualizing tandem repeat sequences
Basic Info
Statistics
- Stars: 10
- Watchers: 1
- Forks: 1
- Open Issues: 3
- Releases: 3
Topics
Metadata Files
README.md
```
|__ | __ \ \ / /_ _|_ /
| | | |) \ \ / / | | / /
| | | _ / \ \/ / | | / /
| | | | \ \ \ / | | / /
|| || _\ \/ |__/__|
``` TRviz is a python library for analyzing tandem repeat sequences. TRviz includes modules for decomposing, encoding, aligning, and visualizing tandem repeat sequences.
Quick Start
Prerequisite
Note Before getting started, ensure you have MAFFT. The current version is tested with MAFFT v7.505.
Step 1: Install TRviz
```bash
Install with pip
pip install trviz
or
bash
Install from source
git clone https://github.com/Jong-hun-Park/trviz.git cd trviz/ pip install . ```
Step 2: Run Your First Analysis
Check out our Jupyter Notebook for code examples and start visualizing tandem repeat sequence right away!
Features Overview

Installation
Use pip for a quick installation, or install from source for more control.
bash
pip install trviz
or
``bash
Install from source
git clone https://github.com/Jong-hun-Park/trviz.git cd trviz/ pip install . ```
Input and Output
Input
- Tandem repeat sequences (alleles)
- A set of motifs for decomposition
Output
- A plot showing the motif composition of the input sequences (pdf by default)
- A plot mapping color to motif (pdf by default)
- Aligned and labeled motifs (text file)
- Motif map, a set of motifs detected in the samples and their labels and frequencies (text file)
For more detailed descriptions, please see full documentation at readthedocs
Code examples
Generating a plot
```python from trviz.main import TandemRepeatVizWorker from trviz.utils import getsampleandsequencefrom_fasta
trvisualizer = TandemRepeatVizWorker() sampleids, trsequences = getsampleandsequencefromfasta(fastafilepath) tr_id = "CACNA1C" motifs = ['GACCCTGACCTGACTAGTTTACAATCACAC']
trvisualizer.generatetrplot(trid, sampleids, tr_sequences, motifs) ```
Motif decomposition
```python from trviz.decomposer import Decomposer
trdecomposer = Decomposer() trsequence = "ACCTTGACCTTGACCTTGACCTTG" motifs = ["ACCTTG"] trdecomposer.decompose(trsequence, motifs)
>>> ["ACCTTG", "ACCTTG", "ACCTTG", "ACCTTG"]
```
Citation:
Jonghun Park, Eli Kaufman, Paul N Valdmanis, Vineet Bafna, TRviz: a Python library for decomposing and visualizing tandem repeat sequences, Bioinformatics Advances, Volume 3, Issue 1, 2023, vbad058
Contribute
Your feedback is valuable! If you encounter any issues during installation or usage, please submit them in the TRviz GitHub Issues.
Owner
- Name: Jonghun Park
- Login: Jong-hun-Park
- Kind: user
- Location: University of California, San Diego
- Repositories: 17
- Profile: https://github.com/Jong-hun-Park
Computer Science Ph.D. student at UC San Diego
Citation (CITATION.cff)
cff-version: 1.0.0
message: "If you use this software, please cite it as below."
authors:
- family-names: "Park"
given-names: "Jonghun"
- family-names: "Kaufman",
given-names: "Eli"
- family-names: " Valdmanis",
given-names: "Paul"
- family-names: "Bafna",
given-names: "Vineet"
title: "TRviz: a Python library for decomposing and visualizing tandem repeat sequences"
version: 0.1.3
doi: "10.1093/bioadv/vbad058"
date-released: 2023-04-26
url: "https://academic.oup.com/bioinformaticsadvances/article/3/1/vbad058/7143378"
preferred-citation:
type: article
authors:
- family-names: "Park"
given-names: "Jonghun"
- family-names: "Kaufman",
given-names: "Eli"
- family-names: " Valdmanis",
given-names: "Paul"
- family-names: "Bafna",
given-names: "Vineet"
doi: "10.1093/bioadv/vbad058"
journal: "Bioinformatics Advances"
month: 4
title: "TRviz: a Python library for decomposing and visualizing tandem repeat sequences"
issue: 1
volume: 3
year: 2023
url: "https://academic.oup.com/bioinformaticsadvances/article/3/1/vbad058/7143378"
GitHub Events
Total
- Issues event: 1
- Watch event: 2
- Issue comment event: 3
- Fork event: 1
Last Year
- Issues event: 1
- Watch event: 2
- Issue comment event: 3
- Fork event: 1
Committers
Last synced: about 3 years ago
All Time
- Total Commits: 136
- Total Committers: 2
- Avg Commits per committer: 68.0
- Development Distribution Score (DDS): 0.007
Top Committers
| Name | Commits | |
|---|---|---|
| Jong-hun-Park | j****k@u****u | 135 |
| Jonghun Park | J****k@u****m | 1 |
Committer Domains (Top 20 + Academic)
Issues and Pull Requests
Last synced: 8 months ago
All Time
- Total issues: 6
- Total pull requests: 2
- Average time to close issues: 7 days
- Average time to close pull requests: about 2 months
- Total issue authors: 5
- Total pull request authors: 1
- Average comments per issue: 1.83
- Average comments per pull request: 0.0
- Merged pull requests: 0
- Bot issues: 0
- Bot pull requests: 0
Past Year
- Issues: 2
- Pull requests: 0
- Average time to close issues: N/A
- Average time to close pull requests: N/A
- Issue authors: 2
- Pull request authors: 0
- Average comments per issue: 2.5
- Average comments per pull request: 0
- Merged pull requests: 0
- Bot issues: 0
- Bot pull requests: 0
Top Authors
Issue Authors
- Jong-hun-Park (2)
- DHmeduni (1)
- aob93 (1)
- ACEnglish (1)
- biorococo (1)
Pull Request Authors
- Jong-hun-Park (2)
Top Labels
Issue Labels
Pull Request Labels
Packages
- Total packages: 1
-
Total downloads:
- pypi 617 last-month
- Total dependent packages: 0
- Total dependent repositories: 0
- Total versions: 9
- Total maintainers: 1
pypi.org: trviz
A python library for decomposing and visualizing tandem repeat sequences
- Homepage: https://github.com/Jong-hun-Park/trviz
- Documentation: https://trviz.readthedocs.io/
- License: BSD License
-
Latest release: 1.2.0
published over 2 years ago
Rankings
Maintainers (1)
Dependencies
- Sphinx ==5.1.1
- myst-parser ==0.18.0
- sphinx-autoapi ==1.9.0
- sphinx-rtd-theme ==1.0.0
- sphinx-rtd-theme *
- sphinxcontrib-applehelp ==1.0.2
- sphinxcontrib-devhelp ==1.0.2
- sphinxcontrib-htmlhelp ==2.0.0
- sphinxcontrib-jsmath ==1.0.1
- sphinxcontrib-qthelp ==1.0.3
- sphinxcontrib-serializinghtml ==1.1.5
- biopython ==1.79
- flake8 *
- matplotlib >=3.2.1
- numpy *
- pandas >=1.0.4
- pytest ==6.2.2
- pytest-mypy >=0.8.1
- pytest-xdist >=2.2.1
- pytest-yapf3 >=0.6.1
- yapf ==0.32.0
- biopython *
- matplotlib *
- numpy *
- actions/checkout v4 composite
- actions/setup-python v3 composite
- actions/upload-artifact v4 composite
- pypa/cibuildwheel v2.16.5 composite