trviz

A python library for decomposing and visualizing tandem repeat sequences

https://github.com/jong-hun-park/trviz

Science Score: 67.0%

This score indicates how likely this project is to be science-related based on various indicators:

✓
CITATION.cff file
Found CITATION.cff file
✓
codemeta.json file
Found codemeta.json file
✓
.zenodo.json file
Found .zenodo.json file
✓
DOI references
Found 2 DOI reference(s) in README
○
Academic publication links
✓
Committers with academic emails
1 of 2 committers (50.0%) from academic institutions
○
Institutional organization owner
○
JOSS paper metadata
○
Scientific vocabulary similarity
Low similarity (13.4%) to scientific vocabulary

Keywords

bioinformatics genomics sequence-alignment str tandem-repeats visualization vntr

Last synced: 4 months ago · JSON representation ·

Repository

A python library for decomposing and visualizing tandem repeat sequences

Basic Info

Host: GitHub
Owner: Jong-hun-Park
License: bsd-3-clause
Language: Python
Default Branch: main
Homepage:
Size: 2.64 MB

Statistics

Stars: 10
Watchers: 1
Forks: 1
Open Issues: 3
Releases: 3

Topics

bioinformatics genomics sequence-alignment str tandem-repeats visualization vntr

Created about 4 years ago · Last pushed almost 2 years ago

Metadata Files

Readme Contributing License Citation

README.md

```

|__ | __ \ \ / /_ _|_ / | | | |) \ \ / / | | / / | | | _ / \ \/ / | | / /
| | | | \ \ \ / | | / / || || _\ \/ |__/__|

``` TRviz is a python library for analyzing tandem repeat sequences. TRviz includes modules for decomposing, encoding, aligning, and visualizing tandem repeat sequences.

Quick Start

Prerequisite

Note Before getting started, ensure you have MAFFT. The current version is tested with MAFFT v7.505.

Step 1: Install TRviz

```bash

Install with pip

pip install trviz orbash

Install from source

git clone https://github.com/Jong-hun-Park/trviz.git cd trviz/ pip install . ```

Step 2: Run Your First Analysis

Check out our Jupyter Notebook for code examples and start visualizing tandem repeat sequence right away!

Features Overview

Installation

Use pip for a quick installation, or install from source for more control. bash pip install trvizor``bash

Install from source

git clone https://github.com/Jong-hun-Park/trviz.git cd trviz/ pip install . ```

Input and Output

Input

Tandem repeat sequences (alleles)
A set of motifs for decomposition

Output

A plot showing the motif composition of the input sequences (pdf by default)
A plot mapping color to motif (pdf by default)
Aligned and labeled motifs (text file)
Motif map, a set of motifs detected in the samples and their labels and frequencies (text file)

For more detailed descriptions, please see full documentation at readthedocs

Code examples

Generating a plot

```python from trviz.main import TandemRepeatVizWorker from trviz.utils import getsampleandsequencefrom_fasta

trvisualizer = TandemRepeatVizWorker() sampleids, trsequences = getsampleandsequencefromfasta(fastafilepath) tr_id = "CACNA1C" motifs = ['GACCCTGACCTGACTAGTTTACAATCACAC']

trvisualizer.generatetrplot(trid, sampleids, tr_sequences, motifs) ```

Motif decomposition

```python from trviz.decomposer import Decomposer

trdecomposer = Decomposer() trsequence = "ACCTTGACCTTGACCTTGACCTTG" motifs = ["ACCTTG"] trdecomposer.decompose(trsequence, motifs)

>>> ["ACCTTG", "ACCTTG", "ACCTTG", "ACCTTG"]

```

Citation:

Jonghun Park, Eli Kaufman, Paul N Valdmanis, Vineet Bafna, TRviz: a Python library for decomposing and visualizing tandem repeat sequences, Bioinformatics Advances, Volume 3, Issue 1, 2023, vbad058

Contribute

Your feedback is valuable! If you encounter any issues during installation or usage, please submit them in the TRviz GitHub Issues.

Owner

Name: Jonghun Park
Login: Jong-hun-Park
Kind: user
Location: University of California, San Diego

Repositories: 17
Profile: https://github.com/Jong-hun-Park

Computer Science Ph.D. student at UC San Diego

Citation (CITATION.cff)

cff-version: 1.0.0
message: "If you use this software, please cite it as below."
authors:
    - family-names: "Park"
      given-names: "Jonghun"
    - family-names: "Kaufman",
      given-names: "Eli"
    - family-names: " Valdmanis",
      given-names: "Paul"
    - family-names: "Bafna",
      given-names: "Vineet"
title: "TRviz: a Python library for decomposing and visualizing tandem repeat sequences"
version: 0.1.3
doi: "10.1093/bioadv/vbad058"
date-released: 2023-04-26
url: "https://academic.oup.com/bioinformaticsadvances/article/3/1/vbad058/7143378"
preferred-citation:
  type: article
  authors:
    - family-names: "Park"
      given-names: "Jonghun"
    - family-names: "Kaufman",
      given-names: "Eli"
    - family-names: " Valdmanis",
      given-names: "Paul"
    - family-names: "Bafna",
      given-names: "Vineet"
  doi: "10.1093/bioadv/vbad058"
  journal: "Bioinformatics Advances"
  month: 4
  title: "TRviz: a Python library for decomposing and visualizing tandem repeat sequences"
  issue: 1
  volume: 3
  year: 2023
  url: "https://academic.oup.com/bioinformaticsadvances/article/3/1/vbad058/7143378"

GitHub Events

Total

Issues event: 1
Watch event: 2
Issue comment event: 3
Fork event: 1

Last Year

Issues event: 1
Watch event: 2
Issue comment event: 3
Fork event: 1

Committers

Last synced: almost 3 years ago

All Time

Total Commits: 136
Total Committers: 2
Avg Commits per committer: 68.0
Development Distribution Score (DDS): 0.007

Top Committers

Name	Email	Commits
Jong-hun-Park	j**k@u**u	135
Jonghun Park	J**k@u**m	1

Committer Domains (Top 20 + Academic)

ucsd.edu: 1

Issues and Pull Requests

Last synced: 4 months ago

All Time

Total issues: 6
Total pull requests: 2
Average time to close issues: 7 days
Average time to close pull requests: about 2 months
Total issue authors: 5
Total pull request authors: 1
Average comments per issue: 1.83
Average comments per pull request: 0.0
Merged pull requests: 0
Bot issues: 0
Bot pull requests: 0

Past Year

Issues: 2
Pull requests: 0
Average time to close issues: N/A
Average time to close pull requests: N/A
Issue authors: 2
Pull request authors: 0
Average comments per issue: 2.5
Average comments per pull request: 0
Merged pull requests: 0
Bot issues: 0
Bot pull requests: 0

View more stats

Top Authors

Issue Authors

Jong-hun-Park (2)
DHmeduni (1)
aob93 (1)
ACEnglish (1)
biorococo (1)

Pull Request Authors

Jong-hun-Park (2)

Top Labels

Issue Labels

enhancement (2)

Pull Request Labels

Packages

Total packages: 1
Total downloads:
- pypi 617 last-month

Total dependent packages: 0
Total dependent repositories: 0
Total versions: 9
Total maintainers: 1

pypi.org: trviz

A python library for decomposing and visualizing tandem repeat sequences

Homepage: https://github.com/Jong-hun-Park/trviz
Documentation: https://trviz.readthedocs.io/
License: BSD License
Latest release: 1.2.0
published about 2 years ago

Versions: 9
Dependent Packages: 0
Dependent Repositories: 0
Downloads: 617 Last month

Rankings

Dependent packages count: 6.6%

Average: 30.1%

Forks count: 30.5%

Dependent repos count: 30.6%

Stargazers count: 39.1%

Downloads: 43.6%

Maintainers (1)

Jonghun

Last synced: 4 months ago

Dependencies

docs/requirements.txt pypi

Sphinx ==5.1.1
myst-parser ==0.18.0
sphinx-autoapi ==1.9.0
sphinx-rtd-theme ==1.0.0
sphinx-rtd-theme *
sphinxcontrib-applehelp ==1.0.2
sphinxcontrib-devhelp ==1.0.2
sphinxcontrib-htmlhelp ==2.0.0
sphinxcontrib-jsmath ==1.0.1
sphinxcontrib-qthelp ==1.0.3
sphinxcontrib-serializinghtml ==1.1.5

requirements.txt pypi

biopython ==1.79
flake8 *
matplotlib >=3.2.1
numpy *
pandas >=1.0.4
pytest ==6.2.2
pytest-mypy >=0.8.1
pytest-xdist >=2.2.1
pytest-yapf3 >=0.6.1
yapf ==0.32.0

setup.py pypi

biopython *
matplotlib *
numpy *

pyproject.toml pypi

.github/workflows/wheel.yml actions

actions/checkout v4 composite
actions/setup-python v3 composite
actions/upload-artifact v4 composite
pypa/cibuildwheel v2.16.5 composite