Science Score: 67.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
    Found CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
    Found 7 DOI reference(s) in README
  • Academic publication links
    Links to: ncbi.nlm.nih.gov, zenodo.org
  • Academic email domains
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (14.0%) to scientific vocabulary

Scientific Fields

Biology Life Sciences - 30% confidence
Last synced: 9 months ago · JSON representation ·

Repository

Basic Info
  • Host: GitHub
  • Owner: mhoban
  • License: gpl-3.0
  • Language: Nextflow
  • Default Branch: main
  • Size: 7.2 MB
Statistics
  • Stars: 7
  • Watchers: 1
  • Forks: 3
  • Open Issues: 28
  • Releases: 3
Created almost 5 years ago · Last pushed 11 months ago
Metadata Files
Readme License Citation

README.md

-. .-.   .-. .-.   .-. .-.   .-. .-.   .-. .-.   .-. .-.   .
||\|||\ /|||\|||\ /|||\|||\ /|||\|||\ /|||\|||\ /|||\|||\ /|
|/ \|||\|||/ \|||\|||/ \|||\|||/ \|||\|||/ \|||\|||/ \|||\||
~   `-~ `-`   `-~ `-`   `-~ `-~   `-~ `-`   `-~ `-`   `-~ `-



DOI

rainbow_bridge

rainbow_bridge is a fully automated pipeline that employs a number of state-of-the-art applications to process eDNA and other metabarcoding data from raw sequences (single- or paired-end) to the generation of (optionally curated) zero-radius operational taxonomic units (zOTUs) and their abundance tables. The pipeline will also collapse assigned taxonomy (via BLAST and/or insect) to lowest common ancestor (LCA) based on user-supplied threshold values as well as perform other finalization steps (e.g., taxon filtering/remapping, decontamination, rarefaction, etc.).

This pipeline uses nextflow and a containerized subsystem (e.g., singularity, podman, etc.) to enable a scalable, portable and reproducible workflow on a local computer, cloud (eventually) or high-performance computing (HPC) clusters.

About this version

This project is a fork of eDNAFlow, rewritten to support the newest version of nextflow and DSL2. It also better supports parallel processing, both through splitting and simultaneously processing large files and the ability to process already-demultiplexed sequence files. In addition, it adds several processing options, such as the ability to classify taxonomy using insect and to produce a phyloseq object as output, among others.

For more information on the original eDNAFlow pipeline and other software used as part of the workflow, please read "eDNAFlow, an automated, reproducible and scalable workflow for analysis of environmental DNA (eDNA) sequences exploiting Nextflow and Singularity" in Molecular Ecology Resources (DOI: https://doi.org/10.1111/1755-0998.13356). If you use rainbow_bridge, we appreciate if you could cite the eDNAFlow paper, the DOI for this project, and the papers describing the underlying software.

Workflow

This flowchart illustrates the general workflow of the rainbow_bridge pipeline (if your browser doesn't support javascript or mermaid or some other necessary thing, you'll just see the code describing the flowchart rather than the flowchart itself). ```mermaid flowchart TB raw[/"Raw fastq reads
(single/paired-end)"/] %% samplemap[/"Filename --> sample ID map"/] demuxed{Sequences demultiplexed?} fastqc("QA/QC report
(FastQC/MultiQC)") fasta[/"Demultiplexed FASTA file in usearch format
(from previous pipeline run)"/] barcode1[/"Barcode file"/] barcode2[/"Barcode file"/] pooledbarcode[/"Split (pooled) barcode file"/]

subgraph filtering["Quality filtering/merging (AdapterRemoval)"] qa[Quality filtering] pe["Paired-end merging (if applicable)"] end

subgraph demuxing["Demultiplexing (OBITools)"] dm1["Assign sequences to samples (ngsfilter)"] dm2["Primer mismatch filtering (ngsfilter)"] dm3["Filter by minimum length (obigrep)
Retain only sequences with both tags"] end

subgraph primer["Primer match/length filter (OBITools)"] pm1["Primer mismatch filtering (ngsfilter)"] pm2["Filter by minimum length (obigrep)"] end

subgraph pooled["Pooled barcode/index demultiplexing"] pp1["Assign sequences to samples (ngsfilter)"] pp2["Primer mismatch filtering (ngsfilter)"] pp3["Filter by minimum length (obigrep)
Retain only sequences with both tags"] end

subgraph prepare["Prepare for denoising"] p1["Relabel to USEARCH/vsearch format (u/vsearch)"] p2["Convert fastq to FASTA"] end

subgraph denoising["Denoising via UNOISE3 (u/vsearch)"] dn1["Dereplicate & 'cluster'"] dn2["Filter minimum abundance"] dn3["Filter chimeras"] dn4["Generate zOTU tables"] end

%% blast("Taxonomy assignment via BLAST (blastn)") nt[/"NCBI nt BLAST database"/] customblast[/"Custom BLAST database(s)"/] subgraph blast["Taxonomy assignment via BLAST"] b1["Assign taxonomy to zOTU sequences (blastn)"] end

insect("Taxonomy assignment via insect
(R/insect)")

taxdb[/"NCBI taxonomy database"/]

subgraph taxonomy["Collapse taxonomy (R)"] tax1["Collapse taxonomy to
lowest-common ancestor (LCA)"] end

subgraph lulu["Table curation (R/lulu)"] l1["Generate match list (blastn)"] l2["LULU curation (lulu)"] l3["Curated zOTU table"] end

subgraph finalization["Finalization (R)"] f1["Taxonomy filtering"] f2["Taxonomic re-mapping"] f3["Decontamination"] f4["Relative abundance filtering"] f5["Rarefaction (vegan/EcolUtils)"] end

subgraph phyloseq["Prepare phyloseq object (R/phyloseq)"] end

barcode1 --> demuxing:::sg barcode2 --> primer:::sg
pooledbarcode --> pooled:::sg raw -. "Initial QA/QC
(if specified)" .-> fastqc raw -->|"(un-gzip if necessary)"| filtering:::sg filtering -. "Filtered/merged QA/QC
(if specified)" .-> fastqc filtering --> demuxed demuxed --->|No| demuxing:::sg demuxed --->|Yes| primer:::sg
demuxed --->|Pooled| pooled:::sg %% demuxed -->|"Yes
(via previous pipeline run)"| x((".")) ---> denoising fasta --------> denoising demuxing --> split("Split sequences by sample (obisplit)") split --> prepare:::sg primer ---> prepare pooled --> split prepare --> denoising:::sg denoising -. "(if specified)" .-> blast:::sg & insect & lulu:::sg taxdb --> taxonomy:::sg blast -. "(if specified)" .-> taxonomy denoising & lulu & insect & blast & taxonomy --> finalization metadata[/"Sample metadata"/] --> phyloseq finalization -.-> phyloseq nt --> blast customblast -. "(if specified)" .-> blast model[/"insect classifier model"/] --> insect

classDef hidden display: none, height: 0px, width: 0px, margi?worn: 0px; classDef sg rx:10,ry:10,margin:10px

```

Table of contents

Setup and testing

The pipeline has only two (although technically three, if you include the java runtime) external dependencies: nextflow and a container system that supports Docker containers. Nextflow additionally requires a java runtime. One place to find that is here, although the openjdk package (available on multiple operating systems) can often be simpler to install. The default container system is singularity, although support for podman is also included (and in theory any other system supported by nextflow that can run Docker containers will also work). To run the pipeline, nextflow and singularity (or podman, etc.) have to be installed or made available for loading as modules (e.g. in the case of running it on an HPC cluster) on your system.

In the install directory of this repository is a script that will install nextflow and singularity. It should support Ubuntu 20.04 and 22.04. For other versions and systems, you can install the components manually following the authors' instructions. You will likely need superuser permissions to install most dependencies, although nextflow can be run from within a user account.

Installation

These instructions are more or less generic, excluding dependency installation. If you are having trouble with that step, you may need to install them manually. There are essentially two ways that rainbowbridge can be run: by cloning the github repository and running the `rainbowbridge.nf` script directly or by using nextflow's built-in github support.

To clone the repository and and install dependencies (for running the .nf script):

  1. Clone the git repository so that all the scripts and test data are downloaded and in one folder. To clone the repository to your directory, run this command in your terminal (remove the '$' if you copy and paste): console $ git clone https://github.com/mhoban/rainbow_bridge.git

  2. Add the directory where you cloned the respository to your system PATH. Assuming you downloaded it into $HOME/rainbow_bridge and you're using bash as your shell, one way you could do that is like this: console $ echo 'export PATH="$HOME/rainbow_bridge:$PATH"' >> $HOME/.bashrc

  3. Next, for Ubuntu and Debian-based systems using singularity, go to the "install" directory which is located inside the "rainbowbridge" directory and run the script `installdependencies.sh. Note that this script assumes your system uses the AMD64 architecture. ``console $ cd rainbow_bridge/install

    $ sudo ./install_dependencies.sh ``` This will install nextflow and singularity to the system. If this fails, try the instructions given below.

To run the pipeline directly from github (note: this method assumes you already have the necessary dependencies installed on the system):

console $ nextflow run -<nextflow-options> mhoban/rainbow_bridge --<rainbow_bridge-options>

Manual dependency installation

Nextflow

For manual installation of Nextflow, follow the instructions at on the nextflow website. The simplest way to do it is to go to the releases page, download the latest version with the -all suffix (e.g., nextflow-24.04.3-all), and make that file executable (you'll need a functioning java runtime for this to work).

Singularity

To install Singularity manually, follow the instructions at singularity installation. If working on HPC, you may need to contact your HPC helpdesk. The Singularity installation how-to is long and complicated, but if you're on a RedHat or Debian-adjacent distro, there are .deb and .rpm packages that can be found at https://github.com/sylabs/singularity/releases/latest.

Podman

Manual podman installation instructions can be found here. rainbowbridge should work with podman out of the box, but you will have to specify a podman profile for it to function properly. There are two profiles built in: `podmanarm, andpodmanintel. These both tell nextflow to use podman for its container system, and the second half just specifies your CPU architecture. Most systems will probably use theintelvariant, but if you are on a newer Mac with Apple silicon, you'll want to use the_arm` variant. To run the pipeline using podman as its container system, specify a profile with the following option (note the single dash in the '-profile' option):

```bash

in this example, we're running on a Mac with the M3 processor

$ rainbowbridge.nf -profile podmanarm ```

Testing installation

The rainbow_bridge-test github repository contains example data to test the various possible input scenarios:

  • Single-end sequencing runs
    • Demultiplexed
    • Undemultiplexed
  • Paired-end sequencing runs
    • Demultiplexed
    • Undemultiplexed

To test the pipeline, clone the repository from https://github.com/mhoban/rainbow_bridge-test.git and see the README there file for more information.

Basic usage

Running the pipeline

As mentioned briefly above, there are two main ways the pipeline can be run: by cloning the repository and calling the main script rainbow_bridge.nf or by using nextflow's github support and running directly from this github repository.

If you have cloned the repository and added its directory to your system PATH, just run the pipline like this (note that nextflow-specific options have a single dash while rainbow_bridge options have double dashes):

console $ rainbow_bridge.nf -<nextflow-options> --<rainbow_bridge-options>

You can also call it using a fully-qualified path (be careful if there are symlinks, because this can break the containerization in unexpected ways):

console $ /path/to/rainbow_bridge.nf -<nextflow-options> --<rainbow_bridge-options>

To run the pipeline without cloning the repository, you can call it like this (note that the option conventions are the same, but nextflow options typically come before the name of the pipeline repository):

console $ nextflow run -<nextflow-options> mhoban/rainbow_bridge --<rainbow_bridge-options>

Input requirements

The most basic requirements for a rainbowbridge run are fastq-formatted sequence file(s) and a file defining PCR primers (and where applicable, sample barcodes)*. Sequences can be either single- or paired-end and may be raw (i.e., one fastq file per sequencing direction), already demultiplexed by the sequencer (i.e., one fastq file per sample per sequencing direction), a combination of the two, or demultiplexed by a previous run of the pipeline (in FASTA format). The demultiplexing strategy must be specified to rainbowbridge using the --demultiplexed-by option. See below for more information.

*The barcode file can be omitted if your fastq files have already had their primers stripped and you pass the --no-pcr option.

Details about the input formats the pipeline supports:

  1. Raw data from the sequencer (i.e. non-demultiplexed). This typically consists of forward/reverse reads each in single large (optionally gzipped) fastq files. You will have one fastq file per sequencing direction, identified by some unique portion of the filename (typically R1/R2). For this type of data, the demultiplexer used in rainbowbridge requires that you have used barcoded primers, such that sequence reads look like this:
    ``` <FWD
    BARCODE> ``` For datasets using this input format, you will need a barcode file that describes how barcode and primer combinations map to sample names.

  2. Data that has already been demultiplexed by the sequencer using Illumina (i5/i7) indices to delineate samples. You will have fastq files for each individual sample and read direction (delineated by a filename pattern like R1/R2), and sequences should still have PCR primers attached, like this:
    <FWD_PRIMER><TARGET_SEQUENCE><REVERSE_PRIMER>

    In most cases these sequences will have the Illumina indices you used to separate samples included at the end of their fastq header, like this:

    @M02308:1:000000000-KVHGP:1:1101:17168:2066 1:N:0:<i5>+<i7>

    For this input format, your barcode file only needs to (optionally) specify PCR primers, since samples are already separated.

  3. "Pooled" sequences, or a combination of barcoded primers and Illumina indices. For this input format, samples are delineated by barcoded primers, but barcode combinations are reused across different Illumina index pairs. This method is supported by rainbow_bridge, but it's not recommended since it's easy for things to go wrong. Sequences will look like they do for non-demultiplexed datasets, but there will be multiple files with different i5/i7 Illumina index pairs, as for demultiplexed data:

    Sequence reads <FWD_BARCODE><FWD_PRIMER><TARGET_SEQUENCE><REVERSE_PRIMER><REVERSER_BARCODE> Sequence headers:

    @M02308:1:000000000-KVHGP:1:1101:17168:2066 1:N:0:<i5>+<i7>

    For this input format, your barcode file must be specially formatted. See below for details.

  4. Data that has been demultiplexed to individual samples and concatenated into a FASTA file in usearch format, typically by a previous run of the pipeline on non-demultiplexed sequence data (as in case 1 above, although output from cases 2 or 3 will work as well). Use this option if you want to re-run the pipeline without repeating the lengthy demultiplexing/merging/quality filtering step(s). The expected input format is a single FASTA file with each sequence labled as <samplename>.N where samplename is the name of the sample and N is just a sequential number, for example:

    ```fasta

    sample1.1 AGCGTCCGATGACTGACTGACTAGCT sample1.2 TACGTACGATCGACGAGTCTACGACTACTGAC sample1.3 TGACTGATCGTACTATCAGAGCTATCATCGACTATCATCGATC sample2.1 ATCGTACTACTAGCGACGAGTCATCACGACGTACTAGTCGA sample2.2 CATGCGACGTACGTACTATCATCATCGAGCAGCTATATATCGATGGTACTAGCTGAC sample2.3 TGACTGATCGTACTATCAGAGCTATCATCGACTATCATCGATC sample3.1 AGCGTCCGATGACTGACTGACTAGCT sample3.2 ATCGTACTACTAGCGACGAGTCATCACGACGTACTAGTCGA sample3.3 CATGCGACGTACGTACTATCATCATCGAGCAGCTATATATCGATGGTACTAGCTGAC ```

    Processing fastq input

Specifying fastq files

In all cases, if you're processing fastq runs, you must specify the location of your sequence reads. Generally, if you're processing runs that have not been demultiplexed by the sequencer, you will have either one (single-end) or two (paired-end) fastq files. If your runs have been demultiplexed or are pooled, you will have one fastq file per individual sample/pool per read direction. If fastq files are gzipped (i.e., they have a .gz extension), they will be uncompressed automatically and the .gz extension will be stripped during processing.

Note: unless you are specifying forward/reverse reads directly (i.e. passing individual filenames), it is best practice to keep reads (fastq files) from different sequencing runs in separate directories. If you do not, because of the way the pipeline uses globs to find files, you could end up with unexpected behavior (e.g., accidentally combining sequences from different sequencing runs in one analysis).

There are a few ways you can tell rainbow_bridge where your reads are:

  • For single-ended runs
    • Non-demultiplexed
      --reads [file]: For non-demultiplexed runs, this points directly to your fastq reads, e.g., '../fastq/B1S7L001.fastq'.
    • Demultiplexed
      --reads [glob/dir]: For demultiplexed/pooled runs, this is either a glob indicating where all the demultiplexed reads can be found, (e.g., '../fastq/*.fastq') or a directory, which will be searched using the glob '*.f*q*'
  • For paired-end runs

    • Non-demultiplexed
      --fwd [file] and --rev [file]: For non-demultiplexed runs, you may use these parameters to specify the forward (--fwd) and reverse (--rev) fastq files directly.
    • Demultiplexed/pooled
      Demultiplexed/pooled sequence reads can be located directly using globs or by specifying directories and (optionally) search patterns.

    When using globs, the following options are available:
    --reads [glob]: A glob directly indicating where all forward/reverse reads can be found. Typically, this will look something like '/dir/*{R1,R2}*.fastq'. This can be as simple or as complicated as you like, but it must be able to find all forward and reverse reads (whose filenames must match apart from their direction). Note that the shell will return these in alphabetical order so that if you have something like '/dir/*{forward,backward}*.fastq', the 'backward' reads will be erroneously treated as forward (since backward comes before forward alphabetically). If you encounter this issue, you can use the --r1 and --r2 options to specify the patterns delineating sequencing direction.
    --fwd [glob], --rev [glob] In lieu of passing a single glob to locate all reads, you may use separate globs for each read direction, e.g., "--fwd '/dir/r1/*R1*.fastq' --rev '/dir/r2/*R2*.fastq'". The same caveat regarding alphabetical order applies to these options.

    When using directories, the following options apply:
    Demultiplexed sequence reads are found using a glob built internally with the values of --reads, --fwd, --rev, --r1, and --r2. This method assumes files with an extension of either .fq or .fastq (with an optional .gz). If your files have other extensions, sue the glob method above.

    --reads [dir]: This parameter optionally specifies the base-directory where forward and reverse reads may be found. If no other option is specified, the glob is built using the default values of --fwd, --rev, --r1, and --r2 (see below)
    --fwd [dir] (default: empty), --rev [dir] (default: empty): these parameters optionally specify subdirectories where forward and reverse reads are stored. If --reads is omitted, the search path is constructed using the values of --fwd and --rev as base directories. If --reads is included, these subdirectories must be within the directory specified with --reads.
    --r1 [pattern] (default: 'R1'), --r2 [pattern] (default: 'R2'): these parameters specify the pattern that distinguishes forward from reverse reads. The default values ('R1' and 'R2') are typical of most files you will receive from the sequencer.

    Using the above parameters, the following glob is constructed:

    If reads, fwd, and rev are included:
    <reads>/{<fwd>,<rev>}/*{<r1>,<r2>}*.f*q* If only fwd and rev are included:
    {<fwd>,<rev>}/*{<r1>,<r2>}*.f*q* If only reads is included:
    <reads>/*{<r1>,<r2>}*.f*q*

    The file exension glob is designed to capture .fastq, .fastq.gz, .fq, and .fq.gz

    For example, if rainbow_bridge is invoked with the following options:
    --reads ../fastq --fwd forward --rev reverse

    fastq files will be located using the glob "../fastq/{forward,reverse}/*{R1,R2}*.f*q*"

Usage examples

Following are some examples of the basic command to run the pipeline on your local machine on single-end/paired-end data with multiple possible barcode files. For each of these examples, I assume rainbow_bridge.nf is in the system path, you're working on a project called example_project, and your directory structure looks something like this:

bash example_project/ # base directory containing project files example_project/fastq/ # directory to hold raw sequence reads example_project/data/ # directory to hold other data (e.g., barcode and/or sample map file(s)) example_project/analysis/ # directory to hold rainbow_bridge analysis output

The pipeline run is started from within the analysis directory. The options used to specify the location of your fastq files make exensive use of globs. For a discussion on how these are treated in the pipeline, see here. There are several ways you can specify where sequence reads are found. The below examples each present one way and a more detailed discussion can be found above.

Non-demultiplexed single-end runs

In this case you will have one fastq file and one or more barcode files containing sample barcodes (forward/reverse) and PCR primers (forward/reverse).

bash $ rainbow_bridge.nf \ --single \ --reads ../fastq/sequence_reads.fastq \ # <-- reads denotes a single .fastq file --barcode '../data/*.tab' # <-- note the glob enclosed in single-quotes [further options]

Previously-demultiplexed single-end runs

In this case, you will have multiple fastq files, each representing one sample and one or more barcode files denoting PCR primers only (i.e., no sample barcodes).

bash $ rainbow_bridge.nf \ --single \ --reads '../fastq/*.fastq' \ # <-- reads is a glob denoting multiple .fastq files --barcode '../data/*.tab' --demultiplexed-by index # <-- specify that reads are already demultiplexed [further options]

Non-demultiplexed paired-end runs

In non-demultiplexed runs, the pipeline assumes you have exactly one forward fastq file and one reverse fastq file.

bash $ rainbow_bridge.nf \ --paired \ --reads ../fastq/ # <--- reads points to a directory containing *R1/R2*.fastq files --barcode '../data/*.tab' [further options]

For previously-demultiplexed paired-end runs

For demultiplexed paired-end runs, you will have two fastq files per sample, each designated by a pattern indicating read direction (typically R1/R2, as in this example).

bash $ rainbow_bridge.nf \ --paired \ --reads ../fastq \ # Here, reads indicates the directory where reads are found. --barcode '../data/*.tab' # by default, the pipeline will search <reads>/*R1|R2*.f*q* --demultiplexed-by index [further options]

Contents of output directories

When the pipeline finishes, output from each step can be found in directories corresponding to each process in the analysis. All output will fall under one of two directories: output or preprocess. output will contain things like QA/QC results, zOTU tables, and taxonomic assignment. preprocess contains the results of the various filtering, trimming, and merging steps (among others). The contents of output directories will by symlinked to files contained within the nextflow-generated internal work directory hierarchy (which you shouldn't have to access directly, except maybe in some case of error). Here is an exhaustive list of all the possible output directories:

| Directory | Subdirectory | Description | Condition | | ----------- | ----------------------------------- | ------------------------------------------------------------ | -------------------------------------------------------- | | preprocess/ | trimmerge/ | Length/quality filtered and (for paired-end runs) merged reads | | | | indexfiltered/ | Filtered/merged sequences with ambiguous indices filtered out | --remove-ambiguous-indices
--demultiplexed-by index/combined | | | ngsfilter/ | ngsfilter-processed reads: primer mismatch and sample annotation (if not previously demultiplexed) | | | | lengthfiltered/ | Length filtered | | | | splitsamples/ | Annotated samples split into individual files | Sequencing run not previously demultiplexed | | | relabeled/ | Relabeled combined FASTA files for denoiser (usearch/vsearch) input | | | | merged/ | Merged relabeled FASTA file for denoising | | | output/ | fastqc/initial/
fastqc/filtered/ | FastQC/MultiQC reports | --fastqc | | | zotus/ | Dereplicated/denoised sequence results
(unique sequences, zOTU sequences, zOTU table) | | | | blast/* | BLAST results. Directory names will reflect the options passed to the blast process as well as the names of the individual databases queried against. | --blast | | | lulu/ | LULU curation results | --lulu | | | taxonomy/lca/* | Results of taxonomy collapser script(s). Directory name will reflect the options passed to the LCA process. | --collapse-taxonomy | | | taxonomy/insect/* | Insect classification results. Directory name will reflect the options passed to the insect process. | --insect | | | phyloseq/ | Phyloseq object | --phyloseq and associated options | | work/ | A bunch of nonsense | All internal and intermediate files processed by nextflow | | | .nextflow/ | various | Hidden nextflow-generated internal folder | |

When things go wrong (interpreting errors)

Occasionally your pipeline run will encounter something it doesn't know how to handle and it will fail. There are two general failure modes: silent and loud.

In some limited cases, the pipeline can fail silently. In this case it will appear to process various steps and then it will stop without any message. Sometimes you can tell something went wrong because all the status boxes are empty. We have done our best to avoid this failure mode but it's occasionally possible that you will encounter it. If you do, the best way to go about solving it is to make sure you have provided all the required command line options, your input files are all there and contain data, and any options that point to files actually point to the files you said they did.

In most cases when something goes wrong the pipeline will fail loudly and you will see something like this:

rainbow_bridge error output

This can be a bit intimidating at first, but there are a few ways to use this information to figure out what went wrong. First, toward the bottom of the readout, you'll see the "Command error" section (highlighted). This contains any error message that the failed process may have produced (technically, anything the script output to stderr). If that's empty, there may still be some output you can look at. To see any output the process may have produced (just note that sometimes it's empty), take a look at the "Work dir" and do the following (here we're using the work dir from the above example):

console $ cat work/2a/7da7dd31811a49b03af88632257520/.command.out $ cat work/2a/7da7dd31811a49b03af88632257520/.command.err # (though this will be empty if "Command error" was empty)

In the example above, there was error output but nothing in the .command.out file. Looking at the error output, we can see that the merged FASTA file was empty. This commonly occurs when your PCR primers fail to match any sequences in the raw reads. In this case, check your barcode file to make sure you're using the correct primers for the sequencing run you're processing. In general, once you've worked out what you think has gone wrong, you can simply run the pipeline again, adjusting any relevant command-line options to hopefully fix the issue.

A note on globs/wildcards

A number of rainbow_bridge command-line options accept file globs (wildcards). These are used when you want to indicate more than one file using a matching pattern. For an in-depth treatment of globs in the bash shell environment, have a look here. For the purposes of this pipeline though, you'll mostly use the following things:

Note: when passing file globs as command-line options, make sure that you enclose them in quotes (e.g., --barcode 'bc*.tab'). If you don't, the glob will be interpreted by the shell rather than rainbow_bridge and parameter values will be incorrect.

*: a star means 'match any string of characters of any length'
For example, the glob 'bc*.tab' will match any filename that begins with 'bc', followed by a sequence of any characters, and finally ending with '.tab'
This pattern will match 'bc1.tab', 'bc2.tab', and 'bconetwo_three.tab', but it will not match 'bc1.tabx'

{}: curly braces are used for multiple possible matches.
The contents can be exact strings or wildcards. Anything that matches any of the given comma-separated strings using an "or" relationship (one OR the other) will be found.
For example, the glob 'seq_*{R1,R2}*.fastq' will match 'seq', followed by any characters, followed by EITHER 'R1' OR 'R2', followed by any characters, and finally ending with '.fastq'.
This pattern will match 'seq_R1.fastq', 'seq_001_002_R2.fastq', and 'seq_123_456_R2_extra
info.fastq', among many others. It will NOT match 'seqR1.fastq' (because it's missing the initial underscore following 'seq').

Description of run options

rainbow_bridge allows for a good deal of customization with regard to which and how various elements of the pipeline are run. All command-line options can be either be passed as-is or saved in a parameters file. For details on saving options in a parameters file, see below.

To see a detailed list of available command-line options run: console $ rainbow_bridge.nf --help

Required options

Specifying sequencing run type

For fastq-based analyses, you must specify whether the sequencing run is single ended or paired-end.

--single: denotes single-end sequencing runs
--paired: denotes paired-end sequencing runs

Note: one of the above options is required (specifying both will throw an error)

Specifying demultiplexing strategy

You must also specify the demultiplexing strategy used when preparing your sequencing libraries.

--demultiplexed-by [strategy]: Specify sample demultiplexing strategy used when processing sequence reads. Accepted values are index (Illumina indices, previously-demultiplexed, the default), barcode (barcoded primers, not demultiplexed), or combined (pooled barcoded primers across Illumina index pairs).

Other required options

Barcode file

Note: a barcode file is optional for demultiplexed runs where PCR primers have already been stripped.

--barcode [file/glob]: Aside from specifying how to find your sequence reads, you must specify barcode file(s) using the --barcode option. If the value passed to --barcode is a glob (enclosed in quotes!), rainbow_bridge will use all matching barcode files for demultiplexing/primer matching. Barcode files should comply with the ngsfilter barcode file format, which is a tab-delimited format used to specify sample barcodes and amplicon primers. It will vary slightly based on whether your runs have been demultiplexed by the sequencer or not. Note that the pipeline can perform a few standalone tasks that do not require barcode files (e.g. collapsing taxonomy to LCA).

The barcode file does not require a header line (i.e., column names), but if one is included it must be prefaced with a '#' (i.e., commented out).

  • Non-demultiplexed runs: This format includes forward/reverse sample barcodes and forward/reverse PCR primers to separate sequences into the appropriate samples. Barcodes are separated with a colon and combined in a single column while primers are given in separate columns. For example:

    assay|sample|barcodes|forwardprimer|reverseprimer|extra_information

    ---|---|---|---|---|--- 16S-Fish|B001|GTGTGACA:AGCTTGAC|CGCTGTTATCCCTADRGTAACT|GACCCTATGGAGCTTTAGAC|EFMSRun103Elib90 16S-Fish|B002|GTGTGACA:GACAACAC|CGCTGTTATCCCTADRGTAACT|GACCCTATGGAGCTTTAGAC|EFMSRun103Elib90

  • Demultiplexed runs: Since sequences have already been separated into samples, this format omits the barcodes (using just a colon, ':' in their place) but includes the primers. For example:

    assay|sample|barcodes|forwardprimer|reverseprimer|extra_information

    ---|---|---|---|---|--- primer|V9_18S|:|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC

In this case, it's not super critical what you call your 'sample' since the files are already separated.

  • Pooled runs: Because pooled runs reuse barcode/primer combinations across different index pairs (here referred to as "pools"), there must be a way to associate specific pools to those barcode/primer pairs. In order to do this, the value in the first column of your barcode file must match the underscore-delimited prefix of your read files.

    For example, if your read files look like this: P1_R1.fastq P1_R2.fastq P2_R1.fastq P2_R2.fastq P3_R1.fastq P3_R2.fastq ... ... Your barcode file should look something like this (note that the first line is ignored since it begins with '#', so the names in the header don't affect the outcome, they're just included for ease of reading):

    pool|sample|barcodes|forwardprimer|reverseprimer|extra_information

    ---|---|---|---|---|--- P1|P1sample1|AGCT:TTGA|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 1 P1|P1sample2|TTAG:ATTG|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 2 P1|P1sample3|GATA:TAGA|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 3 P2|P2sample1|AGCT:TTGA|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 1 P2|P2sample2|TTAG:ATTG|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 2 P2|P2sample3|GATA:TAGA|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 3 P3|P3sample1|AGCT:TTGA|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 1 P3|P3sample2|TTAG:ATTG|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 2 P3|P3_sample3|GATA:TAGA|GTACACACCGCCCGTC|TGATCCTTCTGCAGGTTCACCTAC|barcode/primer combo 3

    As you can see, each barcode/primer combination occurs three times, once for each sequence pool, and the first column indicates the specific pool where that sample name will be assigned.

    When ngsfilter is run, the provided barcode file is split into multiple files and each individual split is applied to a specific read file. If the names/column values do not match, sample names will be incorrectly assigned and there won't be any way to figure out the right ones without re-running the whole pipeline. Thus, make sure that the value in the first column of the barcode file matches the prefix (underscore-delimited) of the read files containing the pool of interest.

BLAST settings

For pipeline runs in which BLAST queries are performed, you must identify the database(s) being used. This can be done using the --blast-db option and/or the $FLOW_BLAST environment variable. See below for more details on how to do this.

Sample IDs

For non-demultiplexed sequencing runs (--demultipexed-by barcode), sample IDs are designated using the sample column of the barcode file. For demultiplexed runs (--demultipexed-by index), sample IDs are generated using the first (shared) part of the read filename(s) before the fwd/rev (R1/R2) pattern (if applicable). For example, the following read pairs:

B1_S7_L001_R1_001.fastq B1_S7_L001_R2_001.fastq B2_S8_L001_R1_001.fastq B2_S8_L001_R2_001.fastq CL1_S2_L001_R1_001.fastq CL1_S2_L001_R2_001.fastq CL2_S3_L001_R1_001.fastq CL2_S3_L001_R2_001.fastq

Will result in the following sample IDs:

B1_S7_L001 B2_S8_L001 CL1_S2_L001 CL2_S3_L001

Re-mapping custom sample IDs

By default for previously-demultiplexed runs, rainbow_bridge will interpret sample IDs from sequence read filenames as outlined above. However, you may also specify a mapping file to translate read filenames into custom sample IDs.

--sample-map [mapfile]: A headerless tab-delimited file that maps sample names to sequence-read filenames.

The specified map file should be a tab-delimited table (without headers) where the first column contains the desired sample ID, the second column contains the read filename (forward read for paired-end reads), and the third column (for paired-end reads only) contains the reverse read filename. To map custom IDs to the read files in the example above, construct a map file as follows (columns are tab-separated, file has no header):

sample_B1 B1_S7_L001_R1_001.fastq B1_S7_L001_R2_001.fastq sample_B2 B2_S8_L001_R1_001.fastq B2_S8_L001_R2_001.fastq sample_CL1 CL1_S2_L001_R1_001.fastq CL1_S2_L001_R2_001.fastq sample_CL2 CL2_S3_L001_R1_001.fastq CL2_S3_L001_R2_001.fastq

This would result in the following sample IDs:

sample_B1 sample_B2 sample_CL1 sample_CL2

NOTE: Make sure the filenames in your sample map match the complete filenames (base names) as they exist on-disk (e.g., if they are gzipped, be sure to include the '.gz' extension in your sample map). This differs from previous versions of the pipeline in which the .gz extension needed to be stripped.

Other options

General

--project [project]: Project name, applied as a prefix to various output filenames. (default: project directory name)
--publish-mode [mode]: Specify how nextflow places files in output directories. See nextflow documentation for supported values (default: symlink)
--fastqc: Output FastQC reports for pre and post filter/merge steps. MultiQC is used for demultiplexed or split runs.

Splitting input

To improve performance, large input files can be split into multiple smaller files and processed in parallel. This option is only available for runs that have not previously been demultiplexed. With the --split option, rainbow_bridge will break up the input reads into smaller files (with the number of reads per file customizable as explained below) and process them in parallel the same way that demultiplexed runs are processed.

--split: Split input fastq files and process in parallel
--split-by [num]: Number of sequences per split fastq chunk (default: 100000)

Length, quality, and merge settings

These settings allow you to set values related to quality filtering and paired-end merging.

--mate-separator [char]: Forward/reverse read mate separator (passed to AdapterRemoval, default: '/')
--min-quality [num]: Minimum Phred score for sequence retention (default: 20)
--min-align-len [num]: Minimum sequence overlap when merging forward/reverse reads (default: 12)
--min-len [num]: Minimum overall sequence length (default: 50)

Sequence filtering (ngsfilter options)

These settings control options passed to the ngsfilter tool and include allowable PCR primer mismatch and whether to retain sequences with ambiguous Illumina indices.

--primer-mismatch [num]: Allowed number of mismatched primer bases (default: 2)
--remove-ambiguous-indices: For previously-demultiplexed or pooled sequencing runs, remove reads that have ambiguous indices (i.e. they have bases other than AGCT). Illumina indices must be included in fastq headers:

@M02308:1:000000000-KVHGP:1:1101:17168:2066 1:N:0:CAAWGTGG+TTCNAAGA
--no-pcr: Skip primer/barcode match and removal (ngsfilter step) for sequencing runs where metabarcoding primers are already removed.
--demuxed-fasta [file]: Skip demultiplexing step and use supplied FASTA (must be in usearch/vsearch format). See above. \ --demuxed-example: Spit out example usearch/vsearch demultiplexed FASTA format
--demux-only: Stop after demultiplexing and splitting raw reads

Assigning taxonomy

These options relate to assignment/collapsing of taxonomy by zOTU sequence. Initial taxonomic assignment is performed using BLAST and/or insect and further refined using lowest common ancestor (LCA) collapse.

BLAST is an alignment-based approach that uses the NCBI GenBank database to match zOTUs to sequences with known taxonomic identity. insect is a phylogenetic (tree-based) approach to taxonomic assignment. It is particularly useful for assigning higher-order (e.g. phylum, order) taxonomy to zOTUs that are otherwise unidentified by BLAST. In the LCA method, BLAST results for each zOTU are compared to one another and a decision is made whether or not to collapse to the next highest taxonomic rank based on a user-defined variability threshold among those results.

BLAST settings

These settings allow you to control how BLAST searches are performed and specify the location of search databases. The only required option (unless BLAST queries are being skipped) is the location of a local BLAST database, which can be set using the command line option --blast-db and/or through the $FLOW_BLAST environment variable. Other options in this category allow you to control BLAST search criteria directly (e.g., e-value, percent match, etc.). For further explanation of these options beyond what is described here, see the blast+ documentation.

The following options are available:

Specifying your database:
--blast-db [blast db name]: Location of a BLAST database (path and name). For example, if the NCBI nt database resides at /usr/local/blast, use --blast-db /usr/local/blast/nt. If you have a custom database called custom_blast in /home/user/customblast, pass --blast-db /home/user/customblast/custom_blast. The "name" of the database is the same as the value passed to the -out parameter of makeblastdb. If you are unsure of the name of a particular blast database, a good way to identify it is that it's the base name of the .ndb file. For example, if you have a directory with a fishes.ndb file, the name of the BLAST database will just be fishes.

By default, rainbow_bridge will use the value of the $FLOW_BLAST environment variable as the primary BLAST database. If $FLOW_BLAST is set, the database it points to will be added in addition to any database(s) passed to --blast-db.

Taxonomic name resolution:
BLAST databases use numerical NCBI taxonomy IDs (taxids) to assign taxonomy to sequences. In order for your results to contain the actual scientific names associated with those taxids, the NCBI BLAST taxonomy database (taxdb) must be available to the pipeline. This can be achieved in several ways:

  • If the taxdb files (taxdb.btd and taxdb.bti) are present in any of the databases passed through --blast-db or $FLOW_BLAST, they will be used for all of the supplied databases.
    • If you are using the NCBI nt database, you most likely already have these files present and won't have to worry about any of this.
  • Taxonomy files can be explicitly specified using the --blast-taxdb option. The option value must point to the directory containaining the two taxdb files.
  • If the taxdb files are missing, they will be automatically downloaded from the NCBI website.

Multiple BLAST databases:
It is possible to query your sequences agains multiple BLAST databases. As mentioned, the pipeline will, by default, use the value of the $FLOW_BLAST environment variable as its first BLAST database. If that variable is set, any value(s) passed to --blast-db will be added as additional databases. Nextflow does not support multiple values for the same option on the command line (e.g., workflow.nf --opt val1 --opt val2), but it does support them when using parameter files. Thus, if you're not using the $FLOW_BLAST variable and/or you want to use multiple custom databases, you'll need to pass them as a list in your parameter file (see here for an example). The pipeline will run BLAST queries agains each database separately and merge the results into a common output file.

All BLAST options:
--blast: Query zOTU sequences against a provided BLAST database.
--blast-db [blastdb]: Specify the location of a BLAST database. The value of this option must be the path and name of a blast database (the 'name' is the basename of the files with the .n** extensions), e.g., /drives/blast/customdb. If the environment variable `$FLOWBLASTis set, its value will be added to the list of databases being searched. <small>**--blast-taxdb [dir]**</small>: Specify the location of the NCBI BLAST taxonomy database files (taxdb.btdandtaxdb.bti). The value of this option must be the directory where these two files can be found. If these files already occur alongside any of the databases passed to--blast-db, they will be reused for all databases. If they are missing entirely, they will be downloaded from the NCBI servers. <small>**--ignore-blast-env**</small>: Ignore the value of the$FLOW_BLAST` environment variable set on the host system when running the pipeline.

BLAST options passed to the NCBI blastn tool:
--blastn-task [task]: Set blast+ task (default: "blastn"). NCBI blastn option: -task.
--max-query-results [num]: Maximum number of BLAST results to return per query sequence (default: 10). See here for important information about this parameter, but mayble also see here for a follow-up discussion. NCBI blastn option: -max_target_seqs.
--percent-identity [num]: Minimum percent identity of matches (default: 95). NCBI blastn option: -perc_identity.
--evalue [num]: BLAST e-value threshold (default: 0.001). NCBI blastn option: -evalue.
--qcov [num]: Minimum percent query coverage (default: 100). NCBI blastn option: -qcov_hsp_perc.

Customizing other BLAST options:
Any supported command-line option can be passed to the NCBI blastn tool by prefacing the option name with --blastn- when calling rainbowbridge:
**`--blastn-<blastn
option> [arg]**</small>: Pass(and optional orgument) toblastn` tool.

For example, the following call: console $ rainbow_bridge.nf --blastn-gapopen 15 --blastn-gapextend 25 --blastn-html Will result in blastn being executed like this: console $ blastn -gapopen 15 -gapextend 25 -html

Classification using insect

These options control taxonomy assignment using the insect algorithm. To run insect on your sequences, you must specify either one of the pre-trained classifier models OR one that you've trained yourself. Insect also takes various parameters to tweak how it does its assignments.

--insect [classifier]: Perform taxonomy assignment using insect. Accepted values of [classifier] are:

  • Filename of local .rds R object containing classifier model
  • One of the following (case-insensitive) primer names:
    MiFish, Crust16S, Fish16S, 18SUni, 18SV4, p23S, mlCOIint, SCL5.8S

| Option value | Marker | Target | Primers | Date trained | |--------------|--------|------------------------|----------------------------------------------------------|--------------| | MiFish | 12S | Fish | MiFishUF/MiFishUR (Miya et al., 2015) | 11-11-2018 | | Crust16S | 16S | Marine crustaceans | Crust16SF/Crust16SR (Berry et al., 2017) | 06-26-2018 | | Fish16S | 16S | Marine fish | Fish16sF/16s2R (Berry et al., 2017; Deagle et al., 2007) | 06-27-2018 | | 18SUni | 18S | Marine eukaryotes | 18S1F/18S400R (Pochon et al., 2017) | 07-09-2018 | | 18SV4 | 18S | Marine eukaryotes | 18SV4F/18SV4R (Stat et al., 2017) | 05-25-2018 | | p23S | 23S | Algae | p23SrVf1/p23SrVr1 (Sherwood & Presting 2007) | 07-15-2018 | | mlCOIint | COI | Metazoans | mlCOIintF/jgHCO2198 (Leray et al., 2013) | 11-24-2018 | | SCL5.8S | ITS2 | Cnidarians and sponges | scl58SF/scl28SR (Brian et al., 2019) | 09-20-2018 |

(see here for more information on classifiers)

--insect-threshold [num]: Minimum Akaike weight for the recursive classification procedure to continue toward the leaves of the tree (default: 0.8)
--insect-offset [num]: Log-odds score offset parameter governing whether the minimum score is met at each node (default: 0)
--insect-min-count [num]: Minimum number of training sequences belonging to a selected child node for the classification to progress (default: 5)
--insect-ping [num]: Numeric value (0--1) indicating whether a nearest neighbor search should be carried out, and if so, what the minimum distance to the nearest neighbor should be for the the recursive classification algorithm to be skipped (default: 0.98)

LCA collapse

Options for the lowest common ancestor (LCA) method of taxonomy refinement.

The LCA method will selectively collapse BLAST assignments to their lowest common ancestor based on user-defined variability and certainty thresholds. This script first filters BLAST results according to minimum quality thresholds (percent identity: --lca-pid and query coverage: --lca-qcov). For cases where zOTU sequences return multiple matches to the same sequence ID, the matches are summarized by the best combination of match scores. Then, results whose percent identity differs from the best result by more than a user-defined amount (--lca-diff) are discarded. Finally, zOTUs with taxonomic assignments that are consistent across remaining BLAST results will receive species-level taxonomy. Otherwise, the taxonomy of that zOTU will be collapsed to the lowest common ancestor of remaining BLAST results (if using NCBI taxonomy, the NCBI taxid for the common ancestor will also be retrieved). Two files are produced: a collapsed taxonomy table and an intermediate table retaining all zOTUs passing minimum quality thresholds. The intermediate table may be useful in determining why a given zOTU may have had its taxonomy collapsed.

LCA options

The following command-line options are available for the LCA collapse method:

--collapse-taxonomy: Collapse assigned BLAST results by lowest common ancestor (LCA)
--standalone-taxonomy: Run LCA script standalone (i.e., separate from the pipeline) against user-supplied data
--blast-file [file]: (Only with --standalone-taxonomy) BLAST result table (e.g., output from the blast process)
--zotu-table [file]: (Only with --standalone-taxonomy) zOTU table file (e.g., output from the denoising process)
--lca-lineage [file]: Tabular file (TSV/CSV) matching taxnomic IDs (taxids) to taxonomic lineage (for use with custom BLAST db)
--taxdump [file]: Previously-downloaded NCBI taxonomy dump zip archive (new_taxdump.zip)
--dropped [str]: Placeholder string for dropped taxonomic levels (default: 'dropped'). Pass "NA" for blank/NA
--lca-qcov [num]: Minimum query coverage for LCA taxonomy refinement (default: 100)
--lca-pid [num]: Minimum percent identity for LCA taxonomy refinement (default: 97)
--lca-diff [num]: Maximum difference between percent identities (with identical query coverage) where shared taxonomy is retained (default: 1)
--lca-taxon-filter [regex]: A regular expression with which to remove unwanted taxa from BLAST results. Defaults to filtering uncultured/environmental/synthetic sequences ('uncultured|environmental sample|clone|synthetic').
--lca-case-insensitive: Ignore case when applying the regex in --lca-taxon-filter (default: false).
--lca-filter-max-qcov: During LCA collapse, retain only BLAST records having the highest query coverage (default: false).

Standalone LCA

rainbow_bridge can run the LCA collapse process independent of the rest of the pipeline. This is useful for experimenting with different values of percent ID and difference threshold, among other things. To run LCA in standalone mode, the pipeline must be run with the --standalone-taxonomy option. In addition to --standalone-taxonomy, you must supply a BLAST results file with the --blast-file option. You may also optionally provide a zOTU table using the --zotu-table option. When running LCA in standalone mode, the output files will be placed in the following directories:

LCA taxonomy file: output/standalone_taxonomy/lca/<settings>
Merged zOTU table (if --zotu-table was present): output/standalone_taxonomy/final

LCA worked example

Here is a brief worked example using default parameters (--lca-pid 97, --lca-qcov 100, --lca-diff 1) and BLAST results for two different zOTUs. In this example, one zOTU will be collapsed to LCA and the other will receive a species-level assignment.

Here is the (abridged) BLAST results table, sorted by zOTU and descending percent identity and query coverage:

|zotu |species |pident|evalue |qcov| |------|------------------------|------|---------|----| |Zotu8 |Acanthurus nigricans |99.505|4.86e-95 |100 | |Zotu8 |Acanthurus achilles |99.505|4.86e-95 |100 | |Zotu8 |Acanthurus nigricans |99.505|4.86e-95 |100 | |Zotu8 |Acanthurus nigricans |99.505|4.86e-95 |100 | |Zotu8 |Ctenochaetus tominiensis|99.505|4.86e-95 |100 | |Zotu8 |Acanthurus japonicus |99.505|4.86e-95 |100 | |Zotu8 |Acanthurus leucosternon |99.01 |5.92e-94 |100 | |Zotu8 |Acanthurus leucosternon |98.515|2.52e-92 |100 | |Zotu11|Halichoeres ornatissimus|100 |4.78e-95 |100 | |Zotu11|Halichoeres ornatissimus|98.995|2.47e-92 |100 | |Zotu11|Halichoeres ornatissimus|98.995|2.47e-92 |100 | |Zotu11|Halichoeres cosmetus |98.492|1.05e-90 |100 | |Zotu11|Halichoeres cosmetus |98.492|1.05e-90 |100 | |Zotu11|Halichoeres cosmetus |98.492|1.05e-90 |100 | |Zotu11|Halichoeres ornatissimus|97.99 |8.63e-92 |100 |

First, the BLAST table is filtered by minimum query coverage and pecent identity, the original number of unique hits are recorded, and the difference in percent identity to the best match is calculated for each zOTU (diff column). We lose several matches within both zOTUs:

|zotu |species |pident|evalue |bitscore|qcov|unique_hits|diff| |------|------------------------|------|--------|--------|----|-----------|----| |Zotu11|Halichoeres ornatissimus|100 |4.78e-95|360 |100 |7 |0 | |Zotu11|Halichoeres cosmetus |98.492|1.05e-90|346 |100 |7 |1.5 | |Zotu8 |Ctenochaetus tominiensis|99.505|4.86e-95|361 |100 |8 |0 | |Zotu8 |Acanthurus nigricans |99.505|4.86e-95|361 |100 |8 |0 | |Zotu8 |Acanthurus japonicus |99.505|4.86e-95|361 |100 |8 |0 | |Zotu8 |Acanthurus leucosternon |99.01 |5.92e-94|356 |100 |8 |0.5 | |Zotu8 |Acanthurus achilles |99.505|4.86e-95|361 |100 |8 |0 |

Then, we retain only those hits with diff value below our threshold. We lose the match to Halichoeres cosmetus:

|zotu |species |pident|evalue |bitscore|qcov|unique_hits|diff| |------|------------------------|------|--------|--------|----|-----------|----| |Zotu11|Halichoeres ornatissimus|100 |4.78e-95|360 |100 |7 |0 | |Zotu8 |Ctenochaetus tominiensis|99.505|4.86e-95|361 |100 |8 |0 | |Zotu8 |Acanthurus nigricans |99.505|4.86e-95|361 |100 |8 |0 | |Zotu8 |Acanthurus japonicus |99.505|4.86e-95|361 |100 |8 |0 | |Zotu8 |Acanthurus leucosternon |99.01 |5.92e-94|356 |100 |8 |0.5 | |Zotu8 |Acanthurus achilles |99.505|4.86e-95|361 |100 |8 |0 |

Finally, we collapse zOTUs with more than one species assignment to lowest common ancestor, with the final result of:

|zotu |domain |kingdom|phylum |class|order|family|genus|species |unique_hits| |------|----------|-------|---------|-----|-----|------|-----|------------------------|-----------| |Zotu8 |Eukaryota |Metazoa|Chordata |Actinopteri|Acanthuriformes|Acanthuridae|dropped|dropped|8| |Zotu11|Eukaryota |Metazoa|Chordata |Actinopteri|Labriformes|Labridae|Halichoeres|Halichoeres ornatissimus|7|

Note that Zotu8 matched both Ctenochaetus and Acanthurus and was collapsed to family level (Acanthuridae) while Zotu11 matched only Halichoeres ornatissimus and so retained its species-level ID.

Using LCA with custom taxonomy and/or BLAST databases

By default, rainbowbridge assumes that taxonomy IDs (taxids) returned from BLAST searches are NCBI taxids. That is, it is assumed that they will match entries in the NCBI taxonomy database. This is true for both NCBI and custom BLAST databases. However, since published reference databases (e.g., PR2) frequently come with associated taxonomic lineage information that may not match NCBI databases, it is also possible to provide that custom lineage data to be used by rainbowbridge (and the LCA process). In order for rainbow_bridge to use your custom taxonomic lineage, you must provide a custom blast database with taxids (see below) that match entries in a custom lineage file. The taxids can be any integers you'd like, since if a custom lineage is given, the pipeline won't attempt to match them to the NCBI database. However, the taxids in the BLAST database must match the taxids in the lineage file. The lineage file is a tabular file (either comma- or tab-separated) in which the first column must contain the (numeric) taxid, and subsequent columns contain whatever taxonomic ranks you want associated with it. Each column (other than taxid) should be named for its taxonomic rank (e.g., species, family, etc.). An example lineage file with the ranks family, genus, and species might look like this:

|taxid|family|genus |species| |-----|------|-----------|-------| |31343|Anguillidae|Anguilla |Anguilla japonica| |31344|Anguillidae|Anguilla |Anguilla anguilla| |31345|Anguillidae|Anguilla |Anguilla australis| |31346|Anguillidae|Anguilla |Anguilla malgumora|

To use a custom taxonomic lineage, pass this tabular lineage file to rainbow_bridge using the --lca-lineage option.

Denoising/dereplication and zOTU inference

These options control how (and by what tool) sequences are denoised and zOTUs are inferred By default, rainbow_bridge uses vsearch (a free 64-bit clone of usearch), which does not suffer from the 4GB memory limit of the free version of usearch. You still retain the option of using either the free (32 bit) or commercial (64 bit) versions of usearch, if you really want to.

--denoiser [tool/path]: Sets the tool used for denoising & chimera removal. Accepted options: 'usearch', 'usearch32', 'vsearch', path to 64-bit usearch executable (default: vsearch)
--min-abundance [num]: Minimum sequence abundance for zOTU determination; sequences with abundances below the specified threshold will be discarded during the denoising process (default: 8)
--alpha [num]: Alpha parameter passed to the UNOISE3 algorithm (see the unoise2 paper for more info) (default: 2.0)
--zotu-identity [num]: Fractional pairwise identity used to match raw reads to zOTUs, equivalent to vsearch --id/usearch -id parameters (default: 0.97)
--usearch: Alias for --denoiser usearch

zOTU curation using LULU

rainbow_bridge includes the option to curate zOTUs using lulu. For a more detailed explantion of these parameters please see the LULU documentation.

--lulu: Curate zOTUs using LULU
--lulu-min-ratio-type [num]: LULU minimum ratio type (accepted values: 'min', 'avg', default: 'min')
--lulu-min-ratio [num]: LULU minimum ratio (default: 1)
--lulu-min-match [num]: LULU minimum threshold of sequence similarity to consider zOTUs as spurious. Choose higher values when using markers with lower genetic variation and/or few expected PCR and sequencing errors (default: 84)
--lulu-min-rc [num]: LULU minimum relative co-occurence rate (default: 0.95)

Resource allocation

These options allow you to allocate resources (CPUs and memory) to rainbow_bridge processes.

--max-memory [mem]: Maximum memory available to nextflow processes, e.g., '8.GB' (default: maximum available system memory)
--max-cpus [num]: Maximum cores available to nextflow processes (default: maximum available system CPUs)
--max-time [time]: Maximum time allocated to each pipeline process, e.g., '2.h' (default: 10d)

Singularity options

Options to control how singularity behaves.

--bind-dir [dir]: Space-separated list of directories to bind within singularity images (must be surrounded by quotations if more than one directory). This is passed to the -B option of singularity run. In most cases any filenames passed to the pipeline will be auto-bound within singularity instances, but you might try this option if you're getting 'file not found' errors.
--singularity-cache [dir]: Location to store downloaded singularity images. May also be specified with the environment variable $NXFSINGULARITYCACHEDIR.

Output products and finalization

Finalization options

These options control the final output of the pipeline and include things like cleanup, abundance filtering, rarefaction, and production of a phyloseq object.

Data cleanup

--taxon-remap [file]: Manually re-map taxonomic classification using criteria in user-supplied table. Argument is a tabular data file (.csv or .tsv) with four columns: original_level, original_value, new_level, and new_value. Taxonomic levels are re-mapped by matching the taxonomic level (e.g., kingdom, phylum, etc.) in the original_level column with the value in the original_value column and assigning the value in new_value to the level in new_level. An example map file might look like this:

| originallevel | originalvalue | newlevel | newvalue | |-------------------|-------------------|--------------|----------------| | phylum | Rhodophyta | kingdom | Plantae | | class | Phaeophyceae | kingdom | Plantae | | class | Ulvophyceae | kingdom | Plantae | | class | Phaeophyceae | phylum | Brown algae | | class | Ulvophyceae | phylum | Green algae |

Using this map file, any sequences assigned to phylum 'Rhodophyta' or classes 'Phaeophyceae' or 'Ulvophyceae' will have their kingdoms assigned to 'Plantae'. Afterward, sequences assigned to class 'Phaeophyceae' will be placed in phylum 'Brown algae' and class 'Ulvophyceae' would be placed in phylum 'Green algae'.

--taxon-filter [file]: Manually filter out or retain specified taxonomic groups or levels. Argument is a tabular data file with three columns: level, value, and action. The level and value column match taxonomic levels to a certain value (e.g., kingtom = 'Metazoa') and the action column determines whether that group is retained (column value = 'retain') or filtered (column value = 'filter'). For example:

| level | value | action | |------------|------------|-----------| | kingdom | Metazoa | retain | | kingdom | Plantae | retain | | family | Bovidae | filter | | family | Canidae | filter |

Using this filter map, all zOTUs assigned to kingdoms 'Metazoa' or 'Plantae' will be retained and all zOTUs assigned to families 'Bovidae' or 'Canidae' will be filtered out.

--taxon-priority [lca/insect]: If both LCA and insect methods were used, the final taxonomic table will be merged. Use this option to specify which method should take priority if assignments disagree. Possible options: 'lca' or 'insect'.

Contamination / negative controls

These options provide different ways to deal with possible contaminates in your dataset. The pipeline currently supports the following methods:

  • Remove all taxa (zOTUs) found in negative control samples.
  • Subtract read counts of taxa found in negative control samples from all samples.
  • Use the R package decontam to control for potential decontamination.

The first two options require a list of negative control sample IDs and the third optionally takes the DNA concentration of each sample before being pooled into the sequencing library.

The following command line options are available:

--controls [file]: Specify sample names of negative field/extraction/filtration controls. Argument is a text file containing one sample ID per line.
--control-action [action]: Action to perform on negative controls. Available options are 'remove' (remove all zOTUs found in negative controls), 'subtract' (subtract read counts of zOTUs found in negative controls), and 'decontam' (use the R package decontam to control for possible contamination) (default: 'remove')
--control-threshold [num]: For the remove action, the minimum read count at which to retain potential contaminates (i.e., for zOTUs found in negative controls, retain if fewer than specified number of reads). For the decontam action, this value is passed to the the isContaminant function in decontam. See package documentation for more information. (default: 0/0.1)
--decontam-method [method]: (for action = 'decontam' only') Method used for determining contaminates. Value is passed to the method argument of the isContaminant function in decontam. See package documentation for more information. (default: 'auto')
--dna-concentration [file]: (for action = 'decontam' only') Tabular file containing DNA concentrations of each sample in ng/ul. A file in .csv or .tsv format with two columns: sample and concentration. The first column contains sample IDs and the second column contains DNA concentrations. Passed to the conc argument of the isContaminant function in decontam. See package documentation for more information.

Abundance filtration and rarefaction

These options provide the ability to filter output by absolute and relative sequence abundance as well as rarefy read counts to minimum depth.

--abundance-filter: Perform relative abundance filtration. If specified, read counts will be converted to relative abundances and read counts below a specified threshold will be set to zero. After zeroing, back-calculate counts to absolute numbers.
--abundance-threshold [num]: If --abundance-filter is passed, the minimum relative abundance below which read counts will be set to zero (default: 0.0001)
--filter-minimum: Remove samples with total read count below a supplied threshold (useful when results are rarefied).
--min-reads [num]: If --filter-minimum is passed, the total read count below which samples will be removed (default: 1000)
--rarefy: Rarefy read counts to minimum depth using specified method.
--rarefaction-method [method]: Method by which to rarefy read counts. Available options are 'perm' and 'phyloseq'. For 'perm', perform permutational rarefaction using the rrarefy.perm function in the EcolUtils package. For 'phyloseq', use the rarefy_even_depth function in the phyloseq package. (default: 'perm')
--permutations [num]: Number of permutations to use in permutational rarefaction (only when --rarefy and --rarefy-method perm are passed). (default: 100)

Other finalization options

--lca-table: Produce final zOTU table merged with LCA taxonomy only.
--insect-table: Produce final zOTU table merged with insect taxonomy only.

Output products

Generating phyloseq objects

rainbow_bridge supports generation of phyloseq objects from pipeline output or user-supplied data. This will produce an RDS file that you can load directly into R and use for downstream analyses. There are a few options that can be specified for this process. Pipeline-generated (i.e., insect or LCA) or user-supplied taxonomic classifications can be used along with the required user-supplied sample metadata.

--phyloseq: Create a phyloseq object from pipeline output (requires the --collapse-taxonomy option).
--metadata [file]: A comma- or tab-separated sample metadata table (required). This can contain any arbitrary sample information, but it must have a header and the first column (preferably called 'sample') must contain sample IDs.
--taxonomy [taxonomy]: Taxonomic classification scheme. This can be one of either lca (to use LCA taxonomy, the default), insect (for insect taxonomy), or the filename of a comma/tab-separated taxonomy table. If user-supplied, the first column of the taxonomy table must be named "OTU" (case-sensitive) and contain zOTU IDs. It may have any number of arbitrary columns of taxonomic classification (e.g., domain, kingdom, phylum, etc.) after that.
--no-tree: Skip creation of phylogenetic tree.
--optimize-tree: Attempt to optimize tree inference. This may take a long time, particularly if there are many zOTU sequences.

Useful examples and tips

Downloading the NCBI BLAST nucleotide database

If you choose to BLAST your zOTUs, you'll need to provide a path to a local GenBank nucleotide (nt) and/or your custom BLAST database. To download the NCBI nucleotide database locally, follow the steps below (these examples all use singularity, but the commands following 'singularity run' are universal):

  1. Download the official BLAST+ container with Singularity: console $ singularity pull blast_latest.sif --dir $HOME/tmp docker://ncbi/blast:latest --dir can be any directory you want it to. It's just the place where the image (.sif file) is saved.

  2. Create a directory where you want to keep the database (here, for example, /opt/storage/blast). From there use the update_blastdb.pl command to download the appropriate database (this is going to take a very long time so it's good to run it inside a screen session or on a computer you can walk away from): console $ mkdir /opt/storage/blast $ cd /opt/storage/blast $ singularity run $HOME/tmp/blast_latest.sif update_blastdb.pl --decompress nt

Making a custom BLAST database

It's a well-known fact that DNA barcode reference libraries are incomplete, and you might want to augment them with your own sequencing efforts. Also, sometimes you don't need to query agains the entire NCBI database. In those cases (and maybe some others), you'll probably benefit from using a custom BLAST database. There is plenty of information about this online, but a simple example is provided here. You'll need, at the very minimum, a FASTA file containing your known sequences. If you want those to be assigned taxonomy, you'll need to create a taxonomic ID mapping file. I'll assume you've pulled the blast singularity image as shown in the previous example. For this example, we've sequenced four taxa, which resulted in the following FASTA file (seqs.fasta):

```fasta

seq1 CAAAGATTAAGCCATGCATGTCTAAGTACAAGCCTAATTAAGGTGAAACCGCGAATGGCTCATTAAATCACACCTAATCT ACTGGATTGTTCCTGTTACTTGGATAACTGCGGTAATTCTGGAGCTAATACATGCGAAAAAGCCTCAACTCACGGCGAGG CGCTTTTATTAGACCAAAACCAAACGGCTCTGCCGTTACTCTGGTGATTCTGAATAACTTTTTGCAGATCGCACGGATTA ATTCCGGCGACAAATCCATCGAAGGTGTGCCCTATCAACTGTCGACTGTGGTATAGACGTCCACAGTGGTTTTGACGGGT AACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACTTCT seq2 CAAAGATTAAGCCATGCATGTCCAAGTACAAGCCTCACTAAGGTGAAACCGCGAATGGCTCATTAAATCACACCTAATCT ACTGGATAGTCAACAGTTACTTGGATAACTGCGGTAATTCTGGAGCTAATACATGCGAAAAGATCCGAACTTACGTGAGG ATCGCTTTTATTAGATCAAAACCAATCGGCCTCGGCTGTAATTTTTGGTGACTCTGAATAACTTTGGGCTGATCGTATAG CCTTGCGCTGACGACATATCCTTCGAAGGTGTGCCCTATCAACTGTCGACTGTGGCATAGACGCCCACAGTGGTTTTGAC GGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTTAAAAACGGCTACCACATCT seq3 CAAAGATTAAGCCATGCATGTCTAAGTACAAGCCTCACTAAGGTGAAACCGCGAATGGCTCATTAAATCACACCTAATCT ACAGGATAATTCAAGTTACTTGGATAACTGCGGTAATTCTGGAGCTAATACATGCTACAAACTGCAACCTTACGGGAGCA GTGCTTTTATTAGATCAAAACCAAACGTCGTAAGACGTACTCTTGGTGACTCTGAATAACTTTGTGCAGATCGTATAGCC TAGTGCTGACGACATATCCTTCGAAGGTGTGCCCTATCAACTGTCGACTGTGGCATAGACGCCCACAGTGGTTTTGACGG GTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTTAAAAACGGCTACCACATCT seq4 CAAAGATTAAGCCATGCATGTGTAAGTTCACACTGATTAACAGTAAAACTGCGGACGGCTCATTACAACAGTACTAACCT ATTTGGATGTTCAACGCTAAAAGGATAACTGCCGCAATTCGGGAGCTAATACTTGCTAAAAGCGTCGTAAGACGTGTTTT TCCTTTCCTTAAATCGATCACCTTTGGTGTCTTCTGAGGAGTCGAGGGAACTTAACGGACCGTATGCTTCGGCGACGGTC GTCCATTCGGAGTACTGACTTATCAAATGTCGATGGTTCGGTATTGGCGAACCATGTTGGTAACGAGTAACGGGGAATCA GGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTGGCACATCT ```

Since you want them to be assigned appropriate taxonomy, you've mapped each sequence to an NCBI taxonomic ID (file can be tab- or space-separated).This file will be called taxid_map:

seq1 9593 seq2 9601 seq3 36314 seq4 352265

Now, to create the custom blast database, we run the following command and you should see something like the given output:

```console $ singularity run -B $(readlink -m .) $HOME/tmp/blastlatest.sif makeblastdb \ -in seqs.fasta \ -parseseqids \ -dbtype nucl \ -taxidmap taxidmap \ -out custom_database

Building a new DB, current time: 03/15/2024 12:43:01 New DB name: /home/justaguy/test/custom_database New DB title: seqs.fasta Sequence type: Nucleotide Keep MBits: T Maximum file size: 3000000000B ```

If you list the files just created, you'll see something like this:

console $ ls -l -rw-rw-r-- 1 justaguy justaguy 32768 Mar 15 12:44 custom_database.ndb -rw-rw-r-- 1 justaguy justaguy 178 Mar 15 12:44 custom_database.nhr -rw-rw-r-- 1 justaguy justaguy 156 Mar 15 12:44 custom_database.nin -rw-rw-r-- 1 justaguy justaguy 588 Mar 15 12:44 custom_database.njs -rw-rw-r-- 1 justaguy justaguy 48 Mar 15 12:44 custom_database.nog -rw-rw-r-- 1 justaguy justaguy 60 Mar 15 12:44 custom_database.nos -rw-rw-r-- 1 justaguy justaguy 56 Mar 15 12:44 custom_database.not -rw-rw-r-- 1 justaguy justaguy 379 Mar 15 12:44 custom_database.nsq -rw-rw-r-- 1 justaguy justaguy 16384 Mar 15 12:44 custom_database.ntf -rw-rw-r-- 1 justaguy justaguy 32 Mar 15 12:44 custom_database.nto -rw-rw-r-- 1 justaguy justaguy 1546 Mar 15 12:42 seqs.fasta -rw-rw-r-- 1 justaguy justaguy 42 Mar 12 14:27 taxid_map

In order to use this custom database with the pipeline, if these files reside in a directory called /users/justaguy/blast, the value you would pass to --blast-db would be /users/justaguy/blast/custom_database

Specifying parameters in a parameter file

All the command-line options outlined in this document can either be passed as shown or, for convenience and repeatability, they may be defined in a parameter file in either YAML or json format. Then, launch the pipeline using the option -params-file [file] (note the single dash before the option, this denotes a nextflow option rather than a rainbow_bridge option). Option names can be entered as-is (they must be quoted if using json format), but leading dashes need to be removed. For example, the option --demultiplexed-by should be entered as demultiplexed-by. Boolean options (i.e., options with no parameter that are just on/off switches such as --single or --paired) should be assigned a value of 'true' or 'false'. Here is an example parameter file in YAML format:

yaml paired: true reads: ../fastq/ fwd: forward rev: reverse demultiplexed-by: index remove-ambiguous-indices: true collapse-taxonomy: true primer-mismatch: 3

and in json format:

json { "paired": true, "reads": "../fastq/", "fwd": "forward", "rev": "reverse", "demultiplexed-by": "index", "remove-ambiguous-indices": true, "collapse-taxonomy": true, "primer-mismatch": 3 }

If the first example above is saved as options.yml, rainbow_bridge can be then executed like this:

console $ rainbow_bridge.nf -params-file options.yml (again, note the single dash)

Which is equivalent to running it like this:

console $ rainbow_bridge.nf \ --paired \ --reads ../fastq/ \ --fwd forward \ --rev reverse \ --demultiplexed-by index \ --remove-ambiguous-indices \ --collapse-taxonomy \ --primer-mismatch 3

Setting multiple values for the same option

One advantage of using a parameter file vs. just passing options on the command line is the ability to pass multiple values for the same option (something that isn't supported by nextflow otherwise). In practice, this is only useful for the --blast-db option, but if you've got multiple BLAST databases, it becomes critical. To pass multiple values to an option, simply put them in a parameter file and pass them as a list.

This is what that looks like in YAML (using --blast-db as the example option):

yaml blast-db: - /opt/blast/fish_blast/fishes - /opt/blast/crab_blast/crabs - /opt/blast/snail_blast/snails

And in json:

json { "blast-db": [ "/opt/blast/fish_blast/fishes", "/opt/blast/crab_blast/crabs", "/opt/blast/snail_blast/snails" ] }

Notification

Nextflow allows the user to be notified upon completion or failure of the pipeline run. To do this, simply pass your email address with the -N option when running rainbow_bridge.nf (again, note the single dash). For example, if you want to launch the pipeline using an options file and receive an email when the run completes:

console $ rainbow_bridge.nf -params-file options.yml -N someguy@nobody.com

Owner

  • Name: mykle hoban
  • Login: mhoban
  • Kind: user

Citation (CITATION.cff)

# This CITATION.cff file was generated with cffinit.
# Visit https://bit.ly/cffinit to generate yours today!

cff-version: 1.2.0
title: >-
  rainbow_bridge: a comprehensive nextflow-based
  metabarcoding pipeline
message: >-
  If you use this software, please cite it using the
  metadata from this file.
type: software
authors:
  - given-names: Mykle L
    family-names: Hoban
    email: mhoban@hawaii.edu
    affiliation: Hawai‘i Institute of Marine Biology
    orcid: 'https://orcid.org/0000-0002-2514-3599'
  - given-names: Mahsa
    family-names: Mousavi-Derazmahalleh
    affiliation: Curtin University
    orcid: 'https://orcid.org/0000-0002-2299-2050'
identifiers:
  - type: doi
    value: 10.5281/zenodo.13845842
repository-code: 'https://github.com/mhoban/rainbow_bridge'
abstract: >-
  rainbow_bridge is a fully automated containerized 
  pipeline based on nextflow that employs a number of
  state-of-the-art applications to process eDNA and other
  metabarcoding data from raw sequences to the generation of
  operational taxonomic units and their abundance tables.
keywords:
  - metabarcoding
  - environmental DNA
  - eDNA
  - biodiversity
license: AGPL-3.0-or-later
commit: 24e1eebec3219733b3aa35cf65c05a8a2e34fa98

GitHub Events

Total
  • Create event: 15
  • Release event: 2
  • Issues event: 43
  • Watch event: 6
  • Delete event: 12
  • Issue comment event: 39
  • Push event: 36
  • Pull request event: 21
  • Fork event: 1
Last Year
  • Create event: 15
  • Release event: 2
  • Issues event: 43
  • Watch event: 6
  • Delete event: 12
  • Issue comment event: 39
  • Push event: 36
  • Pull request event: 21
  • Fork event: 1

Issues and Pull Requests

Last synced: 9 months ago

All Time
  • Total issues: 9
  • Total pull requests: 4
  • Average time to close issues: 22 days
  • Average time to close pull requests: 9 days
  • Total issue authors: 3
  • Total pull request authors: 2
  • Average comments per issue: 0.33
  • Average comments per pull request: 0.5
  • Merged pull requests: 4
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 9
  • Pull requests: 4
  • Average time to close issues: 22 days
  • Average time to close pull requests: 9 days
  • Issue authors: 3
  • Pull request authors: 2
  • Average comments per issue: 0.33
  • Average comments per pull request: 0.5
  • Merged pull requests: 4
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • mhoban (50)
  • cajwalsh (5)
  • cbird808 (5)
  • ericgarciaresearch (2)
  • kllabrador (1)
  • ebfreel (1)
Pull Request Authors
  • mhoban (12)
  • jdselwyn (1)
Top Labels
Issue Labels
enhancement (9) wontfix (3) duplicate (1)
Pull Request Labels

Dependencies

.github/workflows/docker-build.yml actions
  • actions/checkout v3 composite
  • mr-smithers-excellent/docker-build-push v6.4 composite
containers/r/Dockerfile docker
  • bioconductor/r-ver RELEASE_3_17 build