Science Score: 54.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
    Found CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
  • DOI references
    Found 12 DOI reference(s) in README
  • Academic publication links
    Links to: scholar.google
  • Academic email domains
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (15.0%) to scientific vocabulary

Scientific Fields

Biology Life Sciences - 40% confidence
Last synced: 11 months ago · JSON representation ·

Repository

Basic Info
  • Host: GitHub
  • Owner: abdcelikkanat
  • Language: Python
  • Default Branch: development
  • Size: 70.5 MB
Statistics
  • Stars: 0
  • Watchers: 1
  • Forks: 0
  • Open Issues: 0
  • Releases: 0
Created over 1 year ago · Last pushed over 1 year ago
Metadata Files
Readme Changelog Citation

README.md

SemiBin: Metagenomic Binning Using Siamese Neural Networks for short and long reads

BioConda Install Test Status Documentation Status License: MIT

SemiBin is a command tool for metagenomic binning with deep learning, handles both short and long reads.

CONTACT US: Please use GitHub issues for bug reports and the SemiBin users mailing-list for more open-ended discussions or questions.

If you use this software in a publication please cite:

Pan, S.; Zhu, C.; Zhao, XM.; Coelho, LP. A deep siamese neural network improves metagenome-assembled genomes in microbiome datasets across different environments. Nat Commun 13, 2326 (2022). https://doi.org/10.1038/s41467-022-29843-y

The self-supervised approach and the algorithms used for long-read datasets (as well as their benchmarking) are described in

Pan, S.; Zhao, XM; Coelho, LP. SemiBin2: self-supervised contrastive learning leads to better MAGs for short- and long-read sequencing. Bioinformatics Volume 39, Issue Supplement_1, June 2023, Pages i21–i29; https://doi.org/10.1093/bioinformatics/btad209

Basic usage of SemiBin

A tutorial of running SemiBin from scrath can be found here SemiBin tutorial.

Installation:

bash conda create -n SemiBin conda activate SemiBin conda install -c conda-forge -c bioconda semibin

This will install both the SemiBin2 command as well (for backwards compatibility), the old SemiBin command. For new projects, it is recommended that you exclusively use SemiBin2: both commands do the same thing, but SemiBin2 has a slightly nicer interface.

The inputs to the SemiBin are contigs (assembled from the reads) and BAM files (reads mapping to the contigs). In the docs you can see how to generate the inputs starting with a metagenome.

Running with single-sample binning (for example: human gut samples):

bash SemiBin2 single_easy_bin -i contig.fa -b S1.sorted.bam -o output --environment human_gut

(if you are using contigs from long-reads, add the --sequencing-type=long_read argument).

Running with multi-sample binning:

bash SemiBin2 multi_easy_bin -i contig_whole.fa -b *.sorted.bam -o output

The output includes the bins in the output_bins directory (including the bin.*.fa and recluster.*.fa).

Please find more options and details below and read the docs.

Advanced Installation

SemiBin runs (and is continuously tested) on Python 3.7-3.12

Bioconda

The simplest mode is shown above. However, if you want to use SemiBin with GPU (which is faster if you have one available), you need to install PyTorch with GPU support:

bash conda create -n SemiBin conda activate SemiBin conda install -c conda-forge -c bioconda semibin conda install -c pytorch -c nvidia pytorch pytorch-cuda=11.8

MacOS note: you can only install the CPU version of PyTorch in MacOS with conda and you need to install from source to take advantage of a GPU (see #72). For more information on how to install PyTorch, see their documentation.

Source

You will need the following dependencies:

The easiest way to install the dependencies is with conda:

bash conda install -c bioconda bedtools hmmer samtools

Once the dependencies are installed, you can install SemiBin by running:

bash python setup.py install

Optional extra dependencies for running SemiBin1:

Examples of binning

SemiBin runs on single-sample, co-assembly and multi-sample binning. Here we show the simple modes as an example. For the details and examples of every SemiBin subcommand, please read the docs.

Binning assemblies from long reads

Since version 1.4, SemiBin proposes new algorithm (ensemble based DBSCAN algorithm) for binning assemblies from long reads. To use it, you can used the subcommands bin_long or pass the option --sequencing-type=long_read to the single_easy_bin or multi_easy_bin subcommands.

Easy single/co-assembly binning mode

Single sample and co-assembly are handled the same way by SemiBin.

You will need the following inputs:

  1. A contig file (contig.fa in the example below)
  2. BAM file(s) from mapping short reads to the contigs, sorted (mapped_reads.sorted.bam in the example below)

The single_easy_bin command can be used to produce results in a single step.

For example:

bash SemiBin2 \ single_easy_bin \ --input-fasta contig.fa \ --input-bam mapped_reads.sorted.bam \ --environment human_gut \ --output output

Alternatively, you can train a new model for that sample, by not passing in the --environment flag:

bash SemiBin2 \ single_easy_bin \ --input-fasta contig.fa \ --input-bam mapped_reads.sorted.bam \ --output output

The following environments are supported:

  • human_gut
  • dog_gut
  • ocean
  • soil
  • cat_gut
  • human_oral
  • mouse_gut
  • pig_gut
  • built_environment
  • wastewater
  • chicken_caecum (Contributed by Florian Plaza Oñate)
  • global

The global environment can be used if none of the others is appropriate. Note that training a new model can take a lot of time and disk space. Some patience will be required. If you have a lot of samples from the same environment, you can also train a new model from them and reuse it.

Easy multi-samples binning mode

The multi_easy_bin command can be used in multi-samples binning mode:

You will need the following inputs:

  1. A combined contig file
  2. BAM files from mapping

For every contig, format of the name is <sample_name>:<contig_name>, where : is the default separator (it can be changed with the --separator argument). NOTE: Make sure the sample names are unique and the separator does not introduce confusion when splitting. For example:

```

S1:Contig1 AGATAATAAAGATAATAATA S1:Contig2 CGAATTTATCTCAAGAACAAGAAAA S1:Contig3 AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA S2:Contig1 AATGATATAATACTTAATA S2:Contig2 AAAATATTAAAGAAATAATGAAAGAAA S3:Contig1 ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG S3:Contig2 AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT S3:Contig3 CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC ```

You can use this to get the combined contig:

bash SemiBin2 concatenate_fasta -i contig*.fa -o output

If either the sample or the contig names use the default separator (:), you will need to change it with the --separator,-s argument.

After mapping samples (individually) to the combined FASTA file, you can get the results with one line of code:

bash SemiBin2 multi_easy_bin -i concatenated.fa -b *.sorted.bam -o output

Running with abundance information from strobealign-aemb

Strobealign-aemb is a fast abundance estimation method for metagenomic binning. As strobealign-aemb can not provide the mapping information for every position of the contig, so we can not run SemiBin2 with strobealign-aemb in binning modes where samples used smaller 5 and need to split the contigs to generate the must-link constratints.

  1. split the FASTA files to generate the must-link constraints bash python script/generate_split.py -c contig.fa -o output
  2. map reads using strobealign-aemb to generate the abundance information bash strobealign --aemb output/split.fa read1_1.fq read1_2.fq -R 6 > sample1.txt strobealign --aemb output/split.fa read2_1.fq read2_2.fq -R 6 > sample2.txt strobealign --aemb output/split.fa read3_1.fq read3_2.fq -R 6 > sample3.txt strobealign --aemb output/split.fa read4_1.fq read4_2.fq -R 6 > sample4.txt strobealign --aemb output/split.fa read5_1.fq read5_2.fq -R 6 > sample5.txt
  3. Running SemiBin2 (like running SemiBin with BAM files) bash SemiBin2 generate_sequence_features_single -i contig.fa -a *.txt -o output SemiBin2 generate_sequence_features_multi -i contig.fa -a *.txt -s : -o output SemiBin2 single_easy_bin -i contig.fa -a *.txt -o output SemiBin2 multi_easy_bin i contig.fa -a *.txt -s : -o output

Output

The output folder will contain:

  1. Features computed from the data and used for training and clustering
  2. Saved semi-supervised deep learning model
  3. Output bins
  4. Table with basic information about each bin
  5. Some intermediate files

By default, bins are in output_bins directory.

For more details about the output, read the docs.

Owner

  • Name: Abdulkadir Çelikkanat
  • Login: abdcelikkanat
  • Kind: user
  • Location: İstanbul

Citation (CITATION.md)

If you use this software in a publication please cite:

>  Pan, S.; Zhu, C.; Zhao, XM.; Coelho, LP. A deep siamese neural network
>  improves metagenome-assembled genomes in microbiome datasets across
>  different environments. *Nat Commun* **13,** 2326 (2022).
>  https://doi.org/10.1038/s41467-022-29843-y

And

> Pan, S., Zhao, XM; Coelho, LP. SemiBin2: Self-Supervised Contrastive Learning
> Leads to Better MAGs for Short- and Long-Read Sequencing. Bioinformatics  39
> (39 Suppl 1): i21–29. https://doi.org/10.1038/s41467-022-29843-y

GitHub Events

Total
  • Push event: 60
  • Create event: 2
Last Year
  • Push event: 60
  • Create event: 2

Dependencies

.github/workflows/semibin_test.yml actions
  • actions/checkout v3 composite
  • conda-incubator/setup-miniconda v2 composite
docs/requirements.txt pypi
  • mkdocs >=1.3.0
setup.py pypi
  • numexpr *
  • numpy *
  • pandas *
  • python-igraph *
  • pyyaml *
  • requests *
  • scikit-learn *
  • torch *
  • tqdm *