GeneFinder

A Gene Finder framework for Julia.

https://github.com/camilogarciabotero/genefinder.jl

Science Score: 77.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
    Found CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
    Found 3 DOI reference(s) in README
  • Academic publication links
    Links to: zenodo.org
  • Committers with academic emails
    2 of 4 committers (50.0%) from academic institutions
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (15.9%) to scientific vocabulary

Keywords

algorithms bioinformatics biology gene gene-finding orf-search

Keywords from Contributors

interactive numerics matrix-exponential projections finite-volume meshing pde interpretability multi-modal hydrology
Last synced: 7 months ago · JSON representation ·

Repository

A Gene Finder framework for Julia.

Basic Info
Statistics
  • Stars: 16
  • Watchers: 2
  • Forks: 1
  • Open Issues: 3
  • Releases: 31
Topics
algorithms bioinformatics biology gene gene-finding orf-search
Created over 3 years ago · Last pushed about 1 year ago
Metadata Files
Readme Changelog License Citation

README.md


A Gene Finder Framework for the Julia Programming Language.

[![Documentation](https://img.shields.io/badge/documentation-online-blue.svg?logo=Julia&logoColor=white)](https://camilogarciabotero.github.io/GeneFinder.jl/dev/) [![Release](https://img.shields.io/github/release/camilogarciabotero/GeneFinder.jl.svg)](https://github.com/camilogarciabotero/GeneFinder.jl/releases/latest) [![DOI](https://zenodo.org/badge/DOI/10.5281/zenodo.7519184.svg)](https://doi.org/10.5281/zenodo.7519184)
[![GitHub Actions](https://github.com/camilogarciabotero/GeneFinder.jl/actions/workflows/CI.yml/badge.svg)](https://github.com/camilogarciabotero/GeneFinder.jl/actions/workflows/CI.yml) [![License](https://img.shields.io/badge/license-MIT-green.svg)](https://github.com/camilogarciabotero/GeneFinder.jl/blob/main/LICENSE) [![Repo Status](https://www.repostatus.org/badges/latest/wip.svg)](https://www.repostatus.org/#wip) [![Downloads](https://img.shields.io/badge/dynamic/json?url=http%3A%2F%2Fjuliapkgstats.com%2Fapi%2Fv1%2Fmonthly_downloads%2FGeneFinder&query=total_requests&suffix=%2Fmonth&label=Downloads)](http://juliapkgstats.com/pkg/GeneFinder) [![Aqua QA](https://raw.githubusercontent.com/JuliaTesting/Aqua.jl/master/badge.svg)](https://github.com/JuliaTesting/Aqua.jl)

Overview

This is a species-agnostic, algorithm extensible, sequence-anonymous (genome, metagenomes) gene finder library framework for the Julia Language.

The GeneFinder package aims to be a versatile module that enables the application of different gene finding algorithms to the BioSequence type, by providing a common interface and a flexible data structure to store the predicted ORFI or genes. The package is designed to be easily extensible, allowing users to implement their own algorithms and integrate them into the framework.

[!WARNING] This package is currently under development and is not yet ready for production use. The API is subject to change.

Installation

You can install GeneFinder from the julia REPL. Press ] to enter pkg mode, and enter the following command:

julia add GeneFinder

Finding complete and overlapped ORFIs

The main package function is findorfs. Under the hood, the findorfs function is an interface for different gene finding algorithms that can be plugged using the finder keyword argument. By default it uses the NaiveFinder algorithm, which is a simple algorithm that finds all (non-outbounded) ORFIs in a DNA sequence (see the NaiveFinder documentation for more details).

[!NOTE] The minlen kwarg in the NaiveFinder mehtod has been set to 6nt, so it will catch random ORFIs not necesarily genes thus it might consider dna"ATGTGA" -> aa"M*" as a plausible ORFI.

Here is an example of how to use the findorfs function with the NaiveFinder algorithm:

```julia using BioSequences, GeneFinder

> 180195.SAMN03785337.LFLS01000089 -> finds only 1 gene in Prodigal (from Pyrodigal tests)

seq = dna"AACCAGGGCAATATCAGTACCGCGGGCAATGCAACCCTGACTGCCGGCGGTAACCTGAACAGCACTGGCAATCTGACTGTGGGCGGTGTTACCAACGGCACTGCTACTACTGGCAACATCGCACTGACCGGTAACAATGCGCTGAGCGGTCCGGTCAATCTGAATGCGTCGAATGGCACGGTGACCTTGAACACGACCGGCAATACCACGCTCGGTAACGTGACGGCACAAGGCAATGTGACGACCAATGTGTCCAACGGCAGTCTGACGGTTACCGGCAATACGACAGGTGCCAACACCAACCTCAGTGCCAGCGGCAACCTGACCGTGGGTAACCAGGGCAATATCAGTACCGCAGGCAATGCAACCCTGACGGCCGGCGACAACCTGACGAGCACTGGCAATCTGACTGTGGGCGGCGTCACCAACGGCACGGCCACCACCGGCAACATCGCGCTGACCGGTAACAATGCACTGGCTGGTCCTGTCAATCTGAACGCGCCGAACGGCACCGTGACCCTGAACACAACCGGCAATACCACGCTGGGTAATGTCACCGCACAAGGCAATGTGACGACTAATGTGTCCAACGGCAGCCTGACAGTCGCTGGCAATACCACAGGTGCCAACACCAACCTGAGTGCCAGCGGCAATCTGACCGTGGGCAACCAGGGCAATATCAGTACCGCGGGCAATGCAACCCTGACTGCCGGCGGTAACCTGAGC"

orfs = findorfs(seq, finder=NaiveFinder) # use finder=NaiveCollector as an alternative

12-element Vector{ORFI{4, NaiveFinder}}: ORFI{NaiveFinder}(29:40, '+', 2) ORFI{NaiveFinder}(137:145, '+', 2) ORFI{NaiveFinder}(164:184, '+', 2) ORFI{NaiveFinder}(173:184, '+', 2) ORFI{NaiveFinder}(236:241, '+', 2) ORFI{NaiveFinder}(248:268, '+', 2) ORFI{NaiveFinder}(362:373, '+', 2) ORFI{NaiveFinder}(470:496, '+', 2) ORFI{NaiveFinder}(551:574, '+', 2) ORFI{NaiveFinder}(569:574, '+', 2) ORFI{NaiveFinder}(581:601, '+', 2) ORFI{NaiveFinder}(695:706, '+', 2) ```

The ORFI structure displays the location, frame, and strand, but currently does not include the sequence per se. To extract the sequence of an ORFI instance, you can use the sequence method directly on it, or you can also broadcast it over the orfs collection using the dot syntax .:

```julia sequence.(orfs)

12-element Vector{LongSubSeq{DNAAlphabet{4}}}: ATGCAACCCTGA ATGCGCTGA ATGCGTCGAATGGCACGGTGA ATGGCACGGTGA ATGTGA ATGTGTCCAACGGCAGTCTGA ATGCAACCCTGA ATGCACTGGCTGGTCCTGTCAATCTGA ATGTCACCGCACAAGGCAATGTGA ATGTGA ATGTGTCCAACGGCAGCCTGA ATGCAACCCTGA ```

Similarly, you can extract the amino acid sequences of the ORFIs using the translate function.

```julia translate.(orfs)

12-element Vector{LongAA}: MQP* MR* MRRMAR* MAR* M* MCPTAV* MQP* MHWLVLSI* MSPHKAM* M* MCPTAA* MQP* ```

Let's score the ORFIs

ORFIs sequences can be scored using different schemes that evaluate them under a biological context. There are two ways to make this possible: by adding a scoring method to the finder algorithm or by using a scoring method after predicting the ORFIs. The first approach is likely more efficient, but the second approach is more flexible. We will showcase the second approach in this example.

A commonly used scoring scheme for ORFIs is the log-odds ratio score. This score is based on the likelihood of a sequence belonging to a specific stochastic model, such as coding or non-coding. The BioMarkovChains package provides a log_odds_ratio_score method (currently imported), also known as lors, which can be used to score ORFIs using the log-odds ratio approach.

julia orfs = findorfs(seq, finder=NaiveFinder)

The lors method has been overloaded to take an ORFI object and can be used later to calculate the score of the ORFIs.

```julia lors.(orfs)

12-element Vector{Float64}: 0.469404606944017 1.0174520899042823 1.5914902556997463 0.9772187907841964 0.6106494455192994 0.7089167973379216 0.469404606944017 1.5523291911446804 0.5282685400427601 0.6106494455192994 0.7405746713921604 0.469404606944017 ```

We can extend basically any method that scores a BioSequence to score an ORFI object. To see more about scoring ORFIs, check out the Scoring ORFIs section in the documentation.

Writting ORFIs into bioinformatic formats

GeneFinder also now facilitates the generation of FASTA, BED, and GFF files directly from the found ORFIs. This feature is particularly useful for downstream analysis and visualization of the ORFIs. To accomplish this, the package provides the following functions: write_orfs_fna, write_orfs_faa, write_orfs_bed, and write_orfs_gff.

Functionality:

The package provides four distinct functions for writing files in different formats:

| Function | Description | |-------------------|--------------------------------------------------------| | write_orfs_fna | Writes nucleotide sequences in FASTA format. | | write_orfs_faa | Writes amino acid sequences in FASTA format. | | write_orfs_bed | Outputs information in BED format. | | write_orfs_gff | Generates files in GFF format. |

All these function support processing BioSequences instances. To demonstrate the use of the write_* methods with a BioSequence, consider the following example:

```julia using BioSequences, GeneFinder

> 180195.SAMN03785337.LFLS01000089 -> finds only 1 gene in Prodigal (from Pyrodigal tests)

seq = dna"AACCAGGGCAATATCAGTACCGCGGGCAATGCAACCCTGACTGCCGGCGGTAACCTGAACAGCACTGGCAATCTGACTGTGGGCGGTGTTACCAACGGCACTGCTACTACTGGCAACATCGCACTGACCGGTAACAATGCGCTGAGCGGTCCGGTCAATCTGAATGCGTCGAATGGCACGGTGACCTTGAACACGACCGGCAATACCACGCTCGGTAACGTGACGGCACAAGGCAATGTGACGACCAATGTGTCCAACGGCAGTCTGACGGTTACCGGCAATACGACAGGTGCCAACACCAACCTCAGTGCCAGCGGCAACCTGACCGTGGGTAACCAGGGCAATATCAGTACCGCAGGCAATGCAACCCTGACGGCCGGCGACAACCTGACGAGCACTGGCAATCTGACTGTGGGCGGCGTCACCAACGGCACGGCCACCACCGGCAACATCGCGCTGACCGGTAACAATGCACTGGCTGGTCCTGTCAATCTGAACGCGCCGAACGGCACCGTGACCCTGAACACAACCGGCAATACCACGCTGGGTAATGTCACCGCACAAGGCAATGTGACGACTAATGTGTCCAACGGCAGCCTGACAGTCGCTGGCAATACCACAGGTGCCAACACCAACCTGAGTGCCAGCGGCAATCTGACCGTGGGCAACCAGGGCAATATCAGTACCGCGGGCAATGCAACCCTGACTGCCGGCGGTAACCTGAGC" ```

Once a BioSequence object has been created, the write_orfs_fna function proves useful for generating a FASTA file containing the nucleotide sequences of the ORFIs. Notably, the write_orfs* methods support either an IOStream or an IOBuffer as an output argument, allowing flexibility in directing the output either to a file or a buffer. In the following example, we demonstrate writing the output directly to a file.

```julia outfile = "LFLS01000089.fna"

open(outfile, "w") do io writeorfsfna(seq, io, finder=NaiveFinder) # use finder=NaiveCollector as an alternative end ```

```bash cat LFLS01000089.fna

seq id=01 start=29 stop=40 strand=+ frame=2 features=[] ATGCAACCCTGA seq id=02 start=137 stop=145 strand=+ frame=2 features=[] ATGCGCTGA seq id=03 start=164 stop=184 strand=+ frame=2 features=[] ATGCGTCGAATGGCACGGTGA seq id=04 start=173 stop=184 strand=+ frame=2 features=[] ATGGCACGGTGA seq id=05 start=236 stop=241 strand=+ frame=2 features=[] ATGTGA seq id=06 start=248 stop=268 strand=+ frame=2 features=[] ATGTGTCCAACGGCAGTCTGA seq id=07 start=362 stop=373 strand=+ frame=2 features=[] ATGCAACCCTGA seq id=08 start=470 stop=496 strand=+ frame=2 features=[] ATGCACTGGCTGGTCCTGTCAATCTGA seq id=09 start=551 stop=574 strand=+ frame=2 features=[] ATGTCACCGCACAAGGCAATGTGA seq id=10 start=569 stop=574 strand=+ frame=2 features=[] ATGTGA seq id=11 start=581 stop=601 strand=+ frame=2 features=[] ATGTGTCCAACGGCAGCCTGA seq id=12 start=695 stop=706 strand=+ frame=2 features=[] ATGCAACCCTGA ```

This could also be done to writting a FASTA file with the nucleotide sequences of the ORFIs using the write_orfs_fna function. Similarly for the BED and GFF files using the write_orfs_bed and write_orfs_gff functions respectively.

Owner

  • Name: Camilo García
  • Login: camilogarciabotero
  • Kind: user
  • Location: Bogotá, Colombia
  • Company: Universidad de los Andes

Biologist interested in applying bioinformatics and DS tools to understand evolution in different organisms. Currently working on bacteriophages and epigenomics

Citation (CITATION.bib)

@misc{GeneFinder.jl,
	author  = {Camilo García},
	title   = {GeneFinder.jl},
	url     = {https://github.com/camilogarciabotero/GeneFinder.jl},
	version = {v0.0.23},
	year    = {2022},
	month   = {11}
}

GitHub Events

Total
  • Create event: 2
  • Commit comment event: 4
  • Release event: 1
  • Watch event: 1
  • Issue comment event: 1
  • Push event: 54
  • Pull request event: 2
Last Year
  • Create event: 2
  • Commit comment event: 4
  • Release event: 1
  • Watch event: 1
  • Issue comment event: 1
  • Push event: 54
  • Pull request event: 2

Committers

Last synced: over 1 year ago

All Time
  • Total Commits: 583
  • Total Committers: 4
  • Avg Commits per committer: 145.75
  • Development Distribution Score (DDS): 0.086
Past Year
  • Commits: 264
  • Committers: 2
  • Avg Commits per committer: 132.0
  • Development Distribution Score (DDS): 0.004
Top Committers
Name Email Commits
Camilo García c****2@u****o 533
Camilo García c****9@e****o 43
dependabot[bot] 4****] 4
CompatHelper Julia c****y@j****g 3
Committer Domains (Top 20 + Academic)

Issues and Pull Requests

Last synced: 9 months ago

All Time
  • Total issues: 6
  • Total pull requests: 31
  • Average time to close issues: about 2 months
  • Average time to close pull requests: 4 days
  • Total issue authors: 3
  • Total pull request authors: 3
  • Average comments per issue: 5.33
  • Average comments per pull request: 0.23
  • Merged pull requests: 21
  • Bot issues: 0
  • Bot pull requests: 17
Past Year
  • Issues: 0
  • Pull requests: 2
  • Average time to close issues: N/A
  • Average time to close pull requests: about 1 hour
  • Issue authors: 0
  • Pull request authors: 1
  • Average comments per issue: 0
  • Average comments per pull request: 0.0
  • Merged pull requests: 2
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • camilogarciabotero (4)
  • JuliaTagBot (1)
  • LeoWelter (1)
Pull Request Authors
  • camilogarciabotero (20)
  • github-actions[bot] (11)
  • dependabot[bot] (9)
Top Labels
Issue Labels
Pull Request Labels
dependencies (9) enhancement (4)

Packages

  • Total packages: 1
  • Total downloads: unknown
  • Total dependent packages: 0
  • Total dependent repositories: 0
  • Total versions: 28
juliahub.com: GeneFinder

A Gene Finder framework for Julia.

  • Versions: 28
  • Dependent Packages: 0
  • Dependent Repositories: 0
Rankings
Dependent repos count: 9.9%
Average: 35.5%
Dependent packages count: 38.9%
Stargazers count: 39.8%
Forks count: 53.5%
Last synced: 8 months ago

Dependencies

.github/workflows/CI.yml actions
  • actions/checkout v2 composite
  • codecov/codecov-action v2 composite
  • julia-actions/cache v1 composite
  • julia-actions/julia-buildpkg v1 composite
  • julia-actions/julia-docdeploy v1 composite
  • julia-actions/julia-processcoverage v1 composite
  • julia-actions/julia-runtest v1 composite
  • julia-actions/setup-julia v1 composite
.github/workflows/TagBot.yml actions
  • JuliaRegistries/TagBot v1 composite
.github/workflows/CompatHelper.yml actions
.github/workflows/register.yml actions
  • julia-actions/RegisterAction latest composite