rna-tools

πŸ”§rna-tools: a toolbox to analyze sequences, structures and simulations of RNA (and more) used by RNA CASP, RNA PUZZLES, and me ;-) docs @ http://rna-tools.rtfd.io web @ http://rna-tools.online

https://github.com/mmagnus/rna-tools

Science Score: 77.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • βœ“
    CITATION.cff file
    Found CITATION.cff file
  • βœ“
    codemeta.json file
    Found codemeta.json file
  • βœ“
    .zenodo.json file
    Found .zenodo.json file
  • βœ“
    DOI references
    Found 8 DOI reference(s) in README
  • βœ“
    Academic publication links
    Links to: biorxiv.org
  • βœ“
    Committers with academic emails
    5 of 23 committers (21.7%) from academic institutions
  • β—‹
    Institutional organization owner
  • β—‹
    JOSS paper metadata
  • β—‹
    Scientific vocabulary similarity
    Low similarity (14.9%) to scientific vocabulary

Keywords

bioinformatics pdb python rna rna-pdb rna-puzzle rna-structure rna-tools rosetta simrna
Last synced: 7 months ago · JSON representation ·

Repository

πŸ”§rna-tools: a toolbox to analyze sequences, structures and simulations of RNA (and more) used by RNA CASP, RNA PUZZLES, and me ;-) docs @ http://rna-tools.rtfd.io web @ http://rna-tools.online

Basic Info
  • Host: GitHub
  • Owner: mmagnus
  • License: gpl-3.0
  • Language: Jupyter Notebook
  • Default Branch: master
  • Homepage: http://rna-tools.online
  • Size: 114 MB
Statistics
  • Stars: 177
  • Watchers: 10
  • Forks: 43
  • Open Issues: 38
  • Releases: 35
Topics
bioinformatics pdb python rna rna-pdb rna-puzzle rna-structure rna-tools rosetta simrna
Created almost 11 years ago · Last pushed 8 months ago
Metadata Files
Readme Changelog Contributing Funding License Citation

README.md

rna-tools

a toolbox to analyze sequences, structures and simulations of RNA (and way more!)

Look for other our projects at https://github.com/RNA-Puzzles.

rna-tools goes online -> https://rna-tools.online

[![ko-fi](https://ko-fi.com/img/githubbutton_sm.svg)](https://ko-fi.com/R5R6AERGM)

PyPI version PayPal donate button Introduction ------------------------------------------------------------------------------- rna-tools is a core library and a set of programs to run various Python functions related to work, initially, with PDB files of RNA structures, but right now this is a huge toolbox of tools to process various types of RNA data (started around 2013). **That is why in 2019, after publishing our U6 Molecular Cell paper I decided to rename the package to rna-tools. Simply, various tools to work with RNA data: sequences, alignments, structures, trajectories.** If you want access the old version see the [branch](https://github.com/mmagnus/rna-tools/tree/rna-pdb-tools). The software is used by me in my servers **NPDock** (RNA/DNA-protein docking method, http://genesilico.pl/NPDock/) and **SimRNAweb** (RNA 3D structure prediction method, http://iimcb.genesilico.pl/SimRNAweb/) and **mqapRNA** (RNA 3D quality control, http://iimcb.genesilico.pl/mqapRNA/) and other projects [EvoClustRNA](https://github.com/mmagnus/EvoClustRNA) and [RNA-Puzzles-Normalized-submissions](https://github.com/mmagnus/RNA-Puzzles-Normalized-submissions). [Test at Colab](https://colab.research.google.com/drive/1I-W4lPFtaqMSNJCLxh6Ff1l9BYZoo_nG#scrollTo=c86aajqeBsSy) **What is fun here?** `rna-tools` (formerly rna-pdb-tools) is a packages of shell utils that are using the common core library. You can also access functions of the library from your scripts. A command-line tools: ```shell $ rna_pdb_tools.py --is-pdb input/1I9V_A.pdb True $ rna_pdb_tools.py --is-pdb input/image.png False ``` or from a script: ```python >>> from rna_tools_lib import * >>> s = RNAStructure('input/1I9V_A.pdb') >>> s.is_pdb() True ``` or from a Jupyter Notebook:

Fig. Fetch an alignment and generate an RChie plot for it. See more https://github.com/mmagnus/rna-tools/blob/master/rna_tools/tools/rna_alignment/rna_alignment.ipynb

Take a tour http://mmagnus.github.io/rna-tools/#/ and/or read the doc rna-tools.rtfd.io/en/latest/.

Fig. rna_pdb_tools.py --get-rnapuzzle-ready *pdb --inplace

The latest

(see CHANGELOG for more detailed description)

22-05-17 a paper published on our server

rna-tools.online: a Swiss army knife for RNA 3D structure modeling workflow
Marcin Magnus
Nucleic Acids Research
https://doi.org/10.1093/nar/gkac372

22-03-31 rna-tools goes online, http://rna-tools.online

21-05-24 spotifier branched out into own repository to keep RT light https://github.com/mmagnus/yeast-spotifier

20-10/12 mqapRNA: py3 wrappers and include them in RT: RASP, Dfire, RNA3DCNN, QRNA, FARNA(Rosetta), AnalyzeGeometry, ClashScore, eSCORE (barnaba), 3dRNAscore, RNAkb (5pt)

20-08-20 A new structures of splicesome processed with rna-tools to be easily viewed with PyMOL (or as single chains) PyMOL4Spliceosome

20-06-18 A new tool, spotifier, to process yeast plate images into figures

20-03-21 PyMOL Preview Generator a new tool for generation of previews in Finders created :-)

19-11-08 The RNA-Puzzles toolkit paper has been accepted for publication in Nucleic Acid Research :-) Release v3

RNA-Puzzles toolkit: A computational resource of RNA 3D structure benchmark datasets, structure manipulation, and evaluation tools Magnus, Marcin; Antczak, Maciej; Zok, Tomasz; Wiedemann, Jakub ; Lukasiak, Piotr; Cao, Yang ; Bujnicki, Janusz; Westhof, Eric; Szachniuk, Marta; Miao, Zhichao https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkz1108/5651330

19-10-22 We made a searchable index of all the tools. There are around 100 functionalities implemented, enjoy it! Let us know if something is missing or unclear!

19-10-10 rna-tools finally works with Python 3, to get Python 2 version go to this branch However, not all tools can be used with Python 3, for example, ClaRNA is written in Python 2 and we can do nothing about it. So, for now, we suggest using Conda or something else that supports kind of hybrid Python2/Python3 environments. Read more on this here and here

19-10-01 The EvoClustRNA manuscript with the heavy use of rna-tools is accepted for publication!

M. Magnus, M., Kappel, K., Das, R., & Bujnicki, J. M. (2019). RNA 3D structure prediction guided by independent folding of homologous sequences, BMC Bioinformatics, https://github.com/mmagnus/EvoClustRNA https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-3120-y

19-06-15 rna-tools used for spliceosome! :-) is accepted for publication! See this folder for the description of the analysis!

Eysmont, K., Matylla-Kulinska, K., Jaskulska, A., Magnus, M., & Konarska, M. M. (2019). Rearrangements within the U6 snRNA core at the transition between the two catalytic steps of splicing. Molecular Cell https://github.com/mmagnus/rna-tools/tree/master/U6MolCell https://www.cell.com/molecular-cell/pdfExtended/S1097-2765(19)30390-9

See also CHANGELOG.

Table of Contents

Tour

Take a tour http://mmagnus.github.io/rna-tools/#/

rnapdbtools.py

``` usage: rnapdbtools.py [-h] [--version] [-r] [--no-progress-bar] [--renum-atoms] [--renum-nmr] [--renum-residues-dirty] [--undo] [--delete-anisou] [--fix] [--to-mol2] [--split-alt-locations] [-c] [--is-pdb] [--is-nmr] [--nmr-dir NMR_DIR] [--un-nmr] [--orgmode] [--get-chain GET_CHAIN] [--fetch] [--fetch-ba] [--fetch-chain] [--get-seq] [--color-seq] [--ignore-files IGNORE_FILES] [--compact] [--hide-warnings] [--get-ss] [--rosetta2generic] [--no-hr] [--renumber-residues] [--dont-rename-chains] [--dont-fix-missing-atoms] [--inspect] [--collapsed-view] [--cv] [-v] [--mutate MUTATE] [--edit EDIT] [--rename-chain RENAME_CHAIN] [--swap-chains SWAP_CHAINS] [--set-chain SET_CHAIN] [--replace-chain REPLACE_CHAIN] [--delete DELETE] [--extract EXTRACT] [--extract-chain EXTRACT_CHAIN] [--uniq UNIQ] [--chain-first] [--oneline] [--replace-htm] [--fasta] [--cif2pdb] [--pdb2cif] [--mdr] [--get-rnapuzzle-ready] [--rpr] [--keep-hetatm] [--inplace] [--here] [--suffix SUFFIX] [--replace-hetatm] [--dont-report-missing-atoms] [--backbone-only] [--no-backbone] [--bases-only] file [file ...]

rnapdbtools - a swiss army knife to manipulation of RNA pdb structures

Usage::

$ rnapdbtools.py --delete A:46-56 --inplace *.pdb

$ rna_pdb_tools.py --get-seq *
# BujnickiLab_RNApuzzle14_n01bound
> A:1-61
# BujnickiLab_RNApuzzle14_n02bound
> A:1-61
CGUUAGCCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAGCAACGCG
[...]

See rna_pdb_merge_into_one.py to merge PDB files in the order as you like into one NMR-like (multimodel) file

-v is for verbose, --version for version ;)

positional arguments: file file

optional arguments: -h, --help show this help message and exit --version -r, --report get report --no-progress-bar for --no-progress-bar for --rpr --renum-atoms renumber atoms, tested with --get-seq --renum-nmr --renum-residues-dirty --undo undo operation of action done --inplace, , rename "backup files" .pdb~ to pdb, ALL files in the folder, not only ~ related to the last action (that you might want to revert, so be careful) --delete-anisou remove files with ANISOU records, works with --inplace --fix fix a PDB file, ! external program, pdbfixer used to fix missing atoms --to-mol2 fix a PDB file, ! external program, pdbfixer used to fix missing atoms --split-alt-locations @todo -c, --clean get clean structure --is-pdb check if a file is in the pdb format --is-nmr check if a file is NMR-style multiple model pdb --nmr-dir NMR_DIR make NMR-style multiple model pdb file from a set of files

                      rna_pdb_tools.py --nmr-dir . 'cwc15_u5_fragments*.pdb' > ~/Desktop/cwc15-u5.pdb

                    please use '' for pattern file recognition, this is a hack to deal with folders with
                    thousands of models, if you used only *.pdb then the terminal will complain that you
                    selected to many files.

--un-nmr split NMR-style multiple model pdb files into individual models [biopython] --orgmode get a structure in org-mode format --get-chain GETCHAIN get chain, one or many, e.g, A, but now also ABC works --fetch fetch file from the PDB db, e.g., 1xjr, use 'rp' to fetchthe RNA-Puzzles standardizeddataset [around 100 MB] --fetch-ba fetch biological assembly from the PDB db --fetch-chain fetch a structure in extract chain, e.g. 6bk8 H --get-seq get seq --color-seq color seq, works with --get-seq --ignore-files IGNOREFILES files to be ingored, .e.g, 'solution' --compact with --get-seq, get it in compact view' $ rnapdbtools.py --get-seq --compact *.pdb # 20Bujnicki1 ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68 # 20Bujnicki2 ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68 # 20Bujnicki3 ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68 # 20Bujnicki_4

--hide-warnings hide warnings, works with --get-chain, it hides warnings that given changes are not detected in a PDB file --get-ss get secondary structure --rosetta2generic convert ROSETTA-like format to a generic pdb --no-hr do not insert the header into files --renumber-residues by defult is false --dont-rename-chains used only with --get-rnapuzzle-ready. By default: --get-rnapuzzle-ready rename chains from ABC.. to stop behavior switch on this option --dont-fix-missing-atoms used only with --get-rnapuzzle-ready --inspect inspect missing atoms (technically decorator to --get-rnapuzzle-ready without actually doing anything but giving a report on problems) --collapsed-view --cv alias to collapsedview -v, --verbose tell me more what you're doing, please! --mutate MUTATE mutate residues, e.g., --mutate "A:1a+2a+3a+4a,B:1a" to mutate to adenines the first four nucleotides of the chain A and the first nucleotide of the chain B --edit EDIT edit 'A:6>B:200', 'A:2-7>B:2-7' --rename-chain RENAMECHAIN edit 'A>B' to rename chain A to chain B --swap-chains SWAPCHAINS B>A, rename A to _, then B to A, then _ to B --set-chain SETCHAIN set chain for all ATOM lines and TER (quite brutal function) --replace-chain REPLACECHAIN a file PDB name with one chain that will be used to replace the chain in the original PDB file, the chain id in this file has to be the same with the chain id of the original chain --delete DELETE delete the selected fragment, e.g. A:10-16, or for more than one fragment --delete 'A:1-25+30-57' --extract EXTRACT extract the selected fragment, e.g. A:10-16, or for more than one fragment --extract 'A:1-25+30-57' --extract-chain EXTRACTCHAIN extract chain, e.g. A --uniq UNIQ
rnapdbtools.py --get-seq --uniq '[:5]' --compact --chain-first * | sort A:1-121 ACCUUGCGCAACUGGCGAAUCCUGGGGCUGCCGCCGGCAGUACCC...CA # rp13nc3295min.out.1 A:1-123 ACCUUGCGCGACUGGCGAAUCCUGAAGCUGCUUUGAGCGGCUUCG...AG # rp13cp0016min.out.1 A:1-123 ACCUUGCGCGACUGGCGAAUCCUGAAGCUGCUUUGAGCGGCUUCG...AG # zcp6537608aALL-000001_AA A:1-45 57-71 GGGUCGUGACUGGCGAACAGGUGGGAAACCACCGGGGAGCGACCCGCCGCCCGCCUGGGC # solution --chain-first --oneline --replace-htm --fasta with --get-seq, show sequences in fasta format, can be combined with --compact (mind, chains will be separated with ' ' in one line)

                    $ rna_pdb_tools.py --get-seq --fasta --compact input/20_Bujnicki_1.pdb
                    > 20_Bujnicki_1
                    ACCCGCAAGGCCGACGGC GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU

--cif2pdb [PyMOL Python package required] --pdb2cif [PyMOL Python package required] --mdr get structures ready for MD (like rpr but without first)

RNAPUZZLE-READY: --get-rnapuzzle-ready get RNApuzzle ready (keep only standard atoms).' Be default it does not renumber residues, use --renumber-residues [requires BioPython] --rpr alias to get_rnapuzzle ready)

CAN BE COMBINED WITH: --keep-hetatm keep hetatoms --inplace in place edit the file! [experimental, only for getrnapuzzleready, --delete, --get-ss, --get-seq, --edit-pdb] --here save a file next to the original file with auto suffix for --extract it's .extr.pdb --suffix SUFFIX when used with --inplace allows you to change a name of a new file, --suffix del will give _del.pdb (mind added _) --replace-hetatm replace 'HETATM' with 'ATOM' [tested only with --get-rnapuzzle-ready] --dont-report-missing-atoms used only with --get-rnapuzzle-ready --backbone-only used only with --get-rnapuzzle-ready, keep only backbone (= remove bases) --no-backbone used only with --get-rnapuzzle-ready, remove atoms of backbone (define as P OP1 OP2 O5') --bases-only used only with --get-rnapuzzle-ready, keep only atoms of bases ```

Tricks:

$ rna_pdb_tools.py --delete A:48-52 --suffix=noloop --inplace
10_rp17c.out.14.pdb
10_rp17c.out.14_out.pdb
[..]

$ rna_pdb_tools.py --get-rnapuzzle-ready --inplace *.pdb

.. keep original structures in original and use rpr:

  bujnicki_server_ss for i in original/*.pdb; do rna_pdb_tools.py --get-rnapuzzle-ready $i > ${i/.pdb/_rpr.pdb}; done
  bujnicki_server_ss ls
17pz_withSS_all_thrs6.00A_clust01-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust06-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust02-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust07-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust03-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust08-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust04-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust09-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust05-000001_AA_rpr.pdb original

.. or to get structures ready for SimRNA/SimRNAweb use :

$ for i in *pdb; do rna_pdb_tools.py --get-rnapuzzle-ready $i >  ${i/.pdb/_srr.pdb}; done
# at some point there was a seperate function --get_simrna_ready but there is no need for it
# simply use --get-rnapuzzle-ready 

rna-tools loves to be used with parallel (wirte in shell script what you want rna-tools to do) and run to execute it in a set of folders:

parallel --bar --eta --progress 'cp test.sh {} && cd {} && bash test.sh ' ::: *

Tools

The (almost) full list of tools can be found here: https://github.com/mmagnus/rna-tools/blob/master/rna-tools-index.csv

Read more http://rna-tools.readthedocs.io/en/latest/

Docs

Read the documentations at rna-tools.rtfd.io/en/latest/.

Cite

Magnus M, Antczak M, Zok T, Wiedemann J, Lukasiak P, Cao Y, Bujnicki JM, Westhof E, Szachniuk M, Miao Z. RNA-Puzzles toolkit: a computational resource of RNA 3D structure benchmark datasets, structure manipulation, and evaluation tools.
Nucleic Acids Research. 2019
10.1093/nar/gkz1108
https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkz1108/5651330

Used in papers

The papers in which the rna-tools package was used or one of spin-off projects, e.g., RNA-Puzzles-Normalized-submissions, PyMOL4Spliceosome:

[12] C. van der Feltz, B. Nikolai, C. Schneider, J. C. Paulson, X. Fu, and A. A. Hoskins, Saccharomyces cerevisiaeEcm2 Modulates the Catalytic Steps of pre-mRNA Splicing, bioRxiv, vol. 4, pp. 213245, Sep. 2020.

[11] T. Zhang, G. Hu, Y. Yang, J. Wang, and Y. Zhou, All-Atom Knowledge-Based Potential for RNA Structure Discrimination Based on the Distance-Scaled Finite Ideal-Gas Reference State., J. Comput. Biol., vol. 27, no. 6, pp. 856867, Jun. 2020.

[10] F. Stefaniak and J. M. Bujnicki, AnnapuRNA: a scoring function for predicting RNA-small molecule interactions., biorxiv.org 2020 https://github.com/filipsPL/annapurna

[9] G. Chojnowski, M. Magnus, and J. M. Bujnicki, RNA fragment assembly with experimental restraints, (in progress) Jun. 2020. http://iimcb.genesilico.pl/rnamasonry

[8] A. M. Watkins, R. Rangan, and R. Das, FARFAR2: Improved De Novo Rosetta Prediction of Complex Global RNA Folds., Structure, Jun. 2020.

[7] Z. Miao, R. W. Adamiak, M. Antczak, M. J. Boniecki, J. M. Bujnicki, S.-J. Chen, C. Y. Cheng, Y. Cheng, F.-C. Chou, R. Das, N. V. Dokholyan, F. Ding, C. Geniesse, Y. Jiang, A. Joshi, A. Krokhotin, M. Magnus, O. Mailhot, F. Major, T. H. Mann, P. Piatkowski, R. Pluta, M. Popenda, J. Sarzynska, L. Sun, M. Szachniuk, S. Tian, J. Wang, J. Wang, A. M. Watkins, J. Wiedemann, Y. Xiao, X. Xu, J. D. Yesselman, D. Zhang, Y. Zhang, Z. Zhang, C. Zhao, P. Zhao, Y. Zhou, T. Zok, A. Zya, A. Ren, R. T. Batey, B. L. Golden, L. Huang, D. M. Lilley, Y. Liu, D. J. Patel, and E. Westhof, RNA-Puzzles Round IV: 3D structure predictions of four ribozymes and two aptamers., RNA, p. rna.075341.120, May 2020.

[6] M. Magnus, K. Kappel, R. Das, and J. M. Bujnicki, RNA 3D structure prediction guided by independent folding of homologous sequences., BMC Bioinformatics, vol. 20, no. 1, pp. 51215, Oct. 2019. https://github.com/mmagnus/EvoClustRNA

[5] K. Eysmont, K. Matylla-Kulinska, A. Jaskulska, M. Magnus, and M. M. Konarska, Rearrangements within the U6 snRNA Core during the Transition between the Two Catalytic Steps of Splicing., Molecular Cell, vol. 75, no. 3, pp. 538548.e3, Aug. 2019. https://github.com/mmagnus/rna-tools/tree/master/U6MolCell

[4] J. Li, W. Zhu, J. Wang, W. Li, S. Gong, J. Zhang, and W. Wang, RNA3DCNN: Local and global quality assessments of RNA 3D structures using 3D deep convolutional neural networks., PLoS Comput Biol, vol. 14, no. 11, p. e1006514, Nov. 2018. http://doi.org/10.1371/journal.pcbi.1006514

[3] P. Boccaletto, M. Magnus, C. Almeida, A. Zya, A. Astha, R. Pluta, B. Bagiski, E. J. Jankowska, S. Dunin-Horkawicz, T. K. Wirecki, M. J. Boniecki, F. Stefaniak, and J. M. Bujnicki, RNArchitecture: a database and a classification system of RNA families, with a focus on structural information., Nucleic Acids Research, vol. 46, no. 1, pp. D202D205, Jan. 2018. https://iimcb.genesilico.pl/RNArchitecture/

[2] M. Magnus, M. J. Boniecki, W. K. Dawson, and J. M. Bujnicki, SimRNAweb: a web server for RNA 3D structure modeling with optional restraints., Nucleic Acids Research, vol. 44, no. 1, pp. W3159, Jul. 2016. https://iimcb.genesilico.pl/SimRNAweb/

[1] I. Tuszyska, M. Magnus, K. Jonak, W. K. Dawson, and J. M. Bujnicki, NPDock: a web server for protein-nucleic acid docking., Nucleic Acids Research, vol. 43, no. 1, pp. W42530, Jul. 2015. http://iimcb.genesilico.pl/NPDock/

RNA Puzzle Submission

Read at https://rna-tools.readthedocs.io/en/latest/rna-puzzles.html

Inspiration (and alternatives)

  • https://www.rosettacommons.org/docs/latest/application_documentation/rna/RNA-tools
  • http://blue11.bch.msu.edu/mmtsb/convpdb.pl
  • https://github.com/haddocking/pdb-tools
  • https://github.com/graik/biskit
  • https://github.com/harmslab/pdbtools
  • http://ginsberg.med.virginia.edu/Links/Phenix/pdbtools.htm
  • an amazing PDB fixer! https://github.com/openmm/pdbfixer
  • .. and more!

Install

Simply run (this is recommended for most of the users):

$ pip install rna-tools

Get the newest version from this GitHub repository:

$ git clone http://github.com/mmagnus/rna-tools.git
$ cd rna-tools && pip install -e .

or (to install in current ./src/):

pip install -e git+http://github.com/mmagnus/rna-tools.git#egg=rna-tools

Index of tools

The index in a form of a searchable table can be found here.

rna_pdb_tools.py

  1. --get-rnapuzzle-ready format PDB file to be compatible with the "RNA-Puzzle PDB format",
  2. --report get report
  3. --renum-atoms renumber atoms, tested with --get-seq
  4. --renum-residues-dirty
  5. --renumber-residues by defult is false
  6. --delete-anisou remove files with ANISOU records, works with --inplace
  7. --split-alt-locations
  8. --clean get clean structure
  9. --is-pdb check if a file is in the pdb format
  10. --is-nmr check if a file is NMR-style multiple model pdb
  11. --un-nmr Split NMR-style multiple model pdb files into individual models [biopython]
  12. --orgmode get a structure in org-mode format
  13. --get-chain GET_CHAIN
  14. --fetch fetch file from the PDB db
  15. --fetch-ba fetch biological assembly from the PDB db
  16. --get-seq get seq
  17. --compact with --get-seq, get it in compact view'
  18. --get-ss get secondary structure
  19. --rosetta2generic convert ROSETTA-like format to a generic pdb
  20. --get-rnapuzzle-ready
  21. --collapsed-view
  22. --replace-hetatm replace 'HETATM' with 'ATOM' [tested only with --get-rnapuzzle-ready]
  23. --mutate MUTATE mutate residues,
  24. --edit EDIT edit 'A:6>B:200', 'A:2-7>B:2-7'
  25. --rename-chain RENAME_CHAIN
  26. --swap-chains SWAP_CHAINS
  27. --replace-chain REPLACE_CHAIN
  28. --delete DELETE delete the selected fragment, e.g. A:10-16, or for more than one fragment --delete 'A:1-25+30-57'
  29. --extract EXTRACT extract the selected fragment, e.g. A:10-16, or for more than one fragment --extract 'A:1-25+30-57'
  30. --extract-chain EXTRACT_CHAIN

Sequence analysis

  1. BlastPDB.py - a simple Blast search,
  2. RfamSearch.py - a simple Rfam search.

Secondary structure analysis

  1. rnasecondarystructureprediction.py - a wrapper for secondary structure prediction methods, e.g., cyclefold, mcfold,ipknot, RNAsubopt, contextfold, centroidfold, with a use of restraints (if applicable)
  2. rna_dot2ct.py - convert dot notation to ct notation.
  3. secondary structure format conversion tools

Tertiary structure comparison

  1. rna_calc_rmsd.py - calculate RMSDs of structures to the target
  2. rna_calc_evo_rmsd.py - calculate RMSD between structures based on a given alignment and selected residues as defined in the "x line",
  3. rna_calc_inf.py - including multiprocessing based on ClaRNA (in Python 2!)
  4. rna_clanstix.py - a tool for visualizing RNA 3D structures based on pairwise structural similarity with Clans,
  5. rna_prediction_significance.py - calculate significance of an RNA tertiary structure prediction.

Tertiary structure formats

  1. diffpdb - a simple tool to compare text-content of PDB files,

  2. rna_pdb_merge_into_one.py - merge single files into an NMR-style multiple model file PDB file.

Tertiary structure analysis

  1. clarna_app.py - a wrapper to ClaRNA, See also PyMOL4RNA, Python 2!
  2. rna_x3dna.py - a wrapper to 3dna, See also PyMOL4RNA,
  3. ClashCalc.py - a simple clash score calculator, used in NPDock, requires BioPython,

Tertiary structure processing

  1. rna_refinement.py - a wrapper for QRNAS (Quick Refinement of Nucleic Acids)

PyMOL4RNA

  1. Undo ("Quick Save & Load") for PyMOL, CTRL-S & CTRL-Z,
  2. PyMOL4Spliceosome (link to its own repository)
  3. clarna() - contact classification with ClaRNA directly in PyMOL for selected residues,
  4. x3dna() - contact classification with X3DNA directly in PyMOL for selected residues,
  5. ss() - get secondary structures of selected objects,
  6. sav <fn> - save on Desktop a session and a PNG file illustrating the session,
  7. color structure domains according to pre-defined styles, e.g., rp17()
  8. PyMOL Preview Generator for OSX

SimRNA

  1. rna_simrna_cluster.py
  2. rna_simrna_extract.py
  3. rna_simrna_get_data
  4. rna_simrna_lowest.py
  5. SimRNAweb: rna_simrnaweb_download_job.py - download model files, trajectory for a given SimRNAweb job
  6. rna_pdb_merge_structure_with_fragments.py - insert fragments into the structure, used at the SimRNAweb server for modeling with a given pre-define structure,
  7. rna_pdb_edit_occupancy_bfactor.py - edit occupancy or bfactor in PDB file,
  8. rna_pk_simrna_to_one_line.py - convert multi-line SimRNA secondary structure format to one line bracket format,
  9. rna_ss_pk_to_simrna.py - do opposite as previous one, convert one line bracket format with pseudoknots into multi-line SimRNA secondary structure format,
  10. See also simrna_trajectory in Python Classes.

Rosetta

  1. rna_rosetta_n.py
  2. rna_rosetta_check_progress.py
  3. rna_rosetta_min.py
  4. rna_rosetta_cluster.py
  5. rna_rosetta_extract_lowscore_decoys.py
  6. rna_rosetta_run.py
  7. rna_rosetta_head.py

RNA Alignment

  1. get_seq() - get sequence,
  2. get_ss() - get secondary structure for a given sequence,
  3. fetch() - fetch an alignment from Rfam,
  4. cmalign() - aligns the RNA sequences in to the covariance model (CM) in
  5. Rchie() - plotting arc diagrams of RNA secondary structures,
  6. find_core() - finds core of molecules in alignment,

Python Classes

  1. Seq.py - seq processing, including secondary structure prediction
  2. SecondaryStructure.py::draw_ss()
  3. SecondaryStructure.py::parse_vienna_to_pairs()
  4. simrna_trajectory

Other

  1. rnakb_utils - RNAkb-related tools,
  2. rnapuzzle_sender - a script to send PDB files to the RNA-Puzzle organizers,
  3. rnashape2ascii - convert RNA shape data into ascii characters ;-) ``
  4. cluster_load - scripts to view cluster load, based on processing qstat.

Index of Jupyters

  • https://github.com/mmagnus/rna-tools/blob/master/notes/fig3-manuscript.ipynb
  • https://github.com/mmagnus/rna-tools/blob/master/rnatools/tools/rnaalignment/rna_alignment.ipynb

References

Components of rna-tools are based upon the following pieces of scientific literature:

P. J. A. Cock, T. Antao, J. T. Chang, B. A. Chapman, C. J. Cox, A. Dalke, I. Friedberg, T. Hamelryck, F. Kauff, B. Wilczynski, and M. J. L. de Hoon, Biopython: freely available Python tools for computational molecular biology and bioinformatics., Bioinformatics, vol. 25, no. 11, pp. 14221423, Jun. 2009.

M. Rother, K. M. Rother, T. Puton, and J. M. Bujnicki, ModeRNA: a tool for comparative modeling of RNA 3D structure., Nucleic Acids Research, vol. 39, no. 10, pp. 40074022, May 2011.

T. Wale, G. Chojnowski, P. Gierski, and J. M. Bujnicki, ClaRNA: a classifier of contacts in RNA 3D structures ased on a comparative analysis of various classification schemes., Nucleic Acids Research, vol. 42, no. 19, pp. e151e151, Oct. 2014.

and more, see seperate readmes.

Owner

  • Name: Marcin Magnus
  • Login: mmagnus
  • Kind: user
  • Location: Cambridge, MA
  • Company: Harvard, USA

Computational structural RNA biologist at Harvard, USA

Citation (CITATION.cff)

cff-version: 1.2.0
preferred-citation:
    authors:
    - family-names: "Magnus"
      given-names: "Marcin"
      orcid: https://orcid.org/0000-0002-5232-2234
    - family-names: "et"
      given-names: "al"
    title: "RNA-Puzzles toolkit: a computational resource of RNA 3D structure benchmark datasets, structure manipulation, and evaluation tools."
    type: article
    doi: 10.1093/nar/gkz1108
doi: 10.1093/nar/gkz1108
date-released: 2019-00-00
url: "https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gkz1108/5651330"

GitHub Events

Total
  • Create event: 3
  • Issues event: 2
  • Release event: 2
  • Watch event: 25
  • Issue comment event: 2
  • Push event: 21
  • Fork event: 1
Last Year
  • Create event: 3
  • Issues event: 2
  • Release event: 2
  • Watch event: 25
  • Issue comment event: 2
  • Push event: 21
  • Fork event: 1

Committers

Last synced: over 2 years ago

All Time
  • Total Commits: 2,611
  • Total Committers: 23
  • Avg Commits per committer: 113.522
  • Development Distribution Score (DDS): 0.35
Past Year
  • Commits: 110
  • Committers: 5
  • Avg Commits per committer: 22.0
  • Development Distribution Score (DDS): 0.064
Top Committers
Name Email Commits
Marcin Magnus m****x@o****l 1,697
magnus m****s@g****l 534
mmagnus m****s@z****m 283
azyla a****a@g****l 26
Magnus m****s@m****l 19
calmeida c****a@g****l 10
magnus m****s@m****l 8
Pietro Boccaletto p****o@g****l 8
fryzjergda t****x@o****l 4
Marcin Magnus m****s@h****u 3
calmeidaa c****a 3
Tomasz Zok t****k@c****l 2
Marcin Magnus m****s@m****l 2
Marcin Magnus m****s@r****l 2
Marcin Magnus m****s@h****u 2
Kazuya Isawa i****a@g****r 1
Astha08 a****u@g****m 1
Astha08 a****u@g****l 1
Marcin Magnus m****s@m****l 1
Marcin Magnus m****s@b****u 1
Ubuntu u****u@i****l 1
mmagnus m****s@f****u 1
Pietro Boccaletto p****h@g****m 1

Issues and Pull Requests

Last synced: 7 months ago

All Time
  • Total issues: 98
  • Total pull requests: 15
  • Average time to close issues: 2 months
  • Average time to close pull requests: 5 days
  • Total issue authors: 17
  • Total pull request authors: 5
  • Average comments per issue: 0.67
  • Average comments per pull request: 0.4
  • Merged pull requests: 12
  • Bot issues: 0
  • Bot pull requests: 1
Past Year
  • Issues: 3
  • Pull requests: 0
  • Average time to close issues: N/A
  • Average time to close pull requests: N/A
  • Issue authors: 2
  • Pull request authors: 0
  • Average comments per issue: 0.0
  • Average comments per pull request: 0
  • Merged pull requests: 0
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • mmagnus (75)
  • iswaryapj (3)
  • Aazyla (3)
  • filipsPL (2)
  • akashbahai (2)
  • thedjofsis (2)
  • ahorvath (1)
  • febos (1)
  • valentin994 (1)
  • pengzhangzhi (1)
  • kekexin714 (1)
  • mariagviegas (1)
  • Sakshi-singh28 (1)
  • mjustynaPhD (1)
  • marrrcin (1)
Pull Request Authors
  • mmagnus (11)
  • m54x49 (1)
  • edge2992 (1)
  • dependabot[bot] (1)
  • iswaryapj (1)
Top Labels
Issue Labels
feature request (17) bug (10) easy-fix (9) enhancement (8) !!!!!!!!!! (4) rna-tools.online (3) md (2) mq (1) in progress (1)
Pull Request Labels
dependencies (1)

Packages

  • Total packages: 1
  • Total downloads:
    • pypi 293 last-month
  • Total dependent packages: 0
  • Total dependent repositories: 1
  • Total versions: 97
  • Total maintainers: 1
pypi.org: rna-tools

a toolbox to analyze structures and simulations of RNA

  • Versions: 97
  • Dependent Packages: 0
  • Dependent Repositories: 1
  • Downloads: 293 Last month
Rankings
Forks count: 6.3%
Stargazers count: 6.5%
Dependent packages count: 7.3%
Downloads: 10.4%
Average: 10.5%
Dependent repos count: 22.1%
Maintainers (1)
Last synced: 8 months ago

Dependencies

docs/bower.json bower
  • headjs ~1.0.3
docs/docs_requirements_py2.txt pypi
  • biopython ==1.74
  • configparser ==4.0.2
  • future *
  • matplotlib *
  • mysql-connector-python-rf *
  • numpy *
  • pandas *
  • pathlib *
  • progressbar2 *
  • python-Levenshtein *
  • scipy *
  • six *
  • sphinx *
  • sphinx-rtd-theme *
  • sphinxcontrib-autoprogram *
  • sphinxcontrib-napoleon *
  • termcolor *
  • urllib3 *
  • versioneer ==0.18
docs/package.json npm
docs/plugin/multiplex/package.json npm
docs/requirements_for_docs.txt pypi
  • biopython *
  • icecream *
  • matplotlib *
  • mysql-connector-python *
  • numpy *
  • openmm *
  • pandas *
  • progressbar2 *
  • python-Levenshtein *
  • scipy *
  • sphinx *
  • sphinx-rtd-theme *
  • sphinxcontrib-autoprogram *
  • sphinxcontrib-napoleon *
  • termcolor *
  • urllib3 *
  • versioneer ==0.18
setup.py pypi
  • biopython *
  • configparser *
  • csvsort *
  • forgi *
  • icecream *
  • keep *
  • matplotlib *
  • numpy *
  • pandas *
  • progressbar2 *
  • python-Levenshtein *
  • scipy *
  • simplejson *
  • sphinx ==1.6.7
  • sphinx-argparse ==0.1.15
  • sphinx-rtd-theme *
  • sphinxcontrib-autoprogram *
  • sphinxcontrib-napoleon *
  • tqdm *
  • urllib3 *
  • versioneer *
  • wget *
.github/workflows/main.yml actions
  • actions/checkout v3 composite
  • actions/setup-python v4 composite
requirements.txt pypi
  • biopython *
  • configparser *
  • csvsort *
  • icecream *
  • numpy *
  • progressbar2 *
  • simplejson *
  • tqdm *
  • urllib3 *
  • versioneer *
  • wget *