trex

Simultaneous lineage TRacking and EXpression profiling of single cells using RNA-seq

https://github.com/frisen-lab/trex

Science Score: 67.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
    Found CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
    Found 4 DOI reference(s) in README
  • Academic publication links
    Links to: ncbi.nlm.nih.gov, springer.com
  • Academic email domains
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (15.9%) to scientific vocabulary
Last synced: 7 months ago · JSON representation ·

Repository

Simultaneous lineage TRacking and EXpression profiling of single cells using RNA-seq

Basic Info
  • Host: GitHub
  • Owner: frisen-lab
  • License: mit
  • Language: Python
  • Default Branch: main
  • Homepage:
  • Size: 34.7 MB
Statistics
  • Stars: 9
  • Watchers: 3
  • Forks: 6
  • Open Issues: 9
  • Releases: 0
Created over 5 years ago · Last pushed 7 months ago
Metadata Files
Readme Changelog License Citation

README.md

CI status

Overview

TREX is an experimental workflow that enables simultaneous lineage TRacking and EXpression profiling of single cells using RNA-sequencing. The method is described in the paper Clonal relations in the mouse brain revealed by single-cell and spatial transcriptomics.

An essential part of this workflow is presented here: the extraction of genetic barcodes or "cloneIDs" from single-cell or spatial transcriptomes and the reconstruction of related cells/spots.

The tool uses BAM files of one or multiple sequencing libraries as an input for the generation of cloneID count matrices and identifies clonally related cells based on Jaccard similarity between each pair of cloneID+cells.

Currently, TREX is compatible with common RNA-sequencing library preparation methods and data formats provided by 10X Chromium, 10X Visium, Smart-seq2 and 3.

Installation

TREX requires Python 3.7 or newer. We recommend that you install TREX into a "virtual environment", which can be done by running the following commands:

python3 -m venv trex-venv
trex-venv/bin/pip install git+https://github.com/frisen-lab/TREX.git

trex-venv is the name of the directory that will be created and which will contain the virtual environment. You can choose a different name.

Activate the virtual environment by running source trex-venv/bin/activate. You need to repeat this step in every new shell in order to be able to run TREX. Finally, test the installation by running trex --version.

Changelog

See Changelog.

Running TREX on a minimal test dataset

Clone the Git repository or download it as a ZIP file and unpack it. The directory tests/data/ contains a test dataset in the proper format. Run TREX on it:

trex run10x -s 695 -e 724 tests/data/

This will create a folder trex_run/ in the current directory (use the -o option to choose a different folder) with the results.

See the "Runnning TREX" section below for further details.

Running TREX on single-cell data from the Nature Neuroscience paper

Here we show how to run TREX on some of the single-cell data we analyzed in our Nature Neuroscience paper (https://doi.org/10.1038/s41593-022-01011-x).

These instructions have been tested with Cell Ranger 6.1.2, but the original analysis was done with Cell Ranger 2.2.0.

These instructions apply only partially to the spatial data (samples GSM4644079-GSM4644094), see the Visium section below for the differences.

Data

The data is available under GEO accession GSE153424. The instructions below analyze sample GSM4644060 because it is relatively small.

GSM4644060 is also called "brain1str" (str stands for striatum) in the GEO description, and it has the ID "10X41" in Supplementary Table 4 in the paper.

As can be seen on the overview page for GSM4644060, reads for the dataset are available from SRA experiment accession SRX8627776, which in turn links to two run accessions: * SRR12103475 * SRR12103476

We use the run accessions to retrieve the data.

Prerequisites

  • Go to the Cell Ranger download page. Download and install Cell Ranger.
  • Download and extract the mouse reference dataset refdata-gex-mm10-2020-A.tar.gz:

    curl -O https://cf.10xgenomics.com/supp/cell-exp/refdata-gex-mm10-2020-A.tar.gz tar xvf refdata-gex-mm10-2020-A.tar.gz

  • Create a custom reference by adding an extra chrH2B-EGFP-N contig (EGFP-cloneID virus) to the above mouse reference dataset. references/ refers to the directory in this repository. cellranger mkref takes about one hour. You may choose to continue to the next step (downloading reads) while this is running.

    cat refdata-gex-mm10-2020-A/fasta/genome.fa references/chrH2B-EGFP-N.fa > mm10H2B-EGFP-30Ngenome.fa cat refdata-gex-mm10-2020-A/genes/genes.gtf references/chrH2B-EGFP-N.gtf > mm10H2B-EGFP-30Ngenes.gtf cellranger mkref --genome=mm10H2B-EGFP-30N --fasta=mm10H2B-EGFP-30Ngenome.fa --genes=mm10H2B-EGFP-30Ngenes.gtf > mkrefmm10_H2B-EGFP-30N.out

Downloads reads

Create a fastq directory and change into it:

mkdir fastq
cd fastq

If you do not have it, install fastq-dump. For example, if you have Conda (with the Bioconda channels activated), run

conda create -n trex sra-tools
conda activate trex

Download the reads:

fastq-dump --gzip --split-3 --defline-qual '+' --defline-seq '@$ac.$sn' SRR12103475 SRR12103476

Rename the files so that Cell Ranger can find them:

mv SRR12103475_1.fastq.gz SRR12103475_S1_L001_R1_001.fastq.gz
mv SRR12103475_2.fastq.gz SRR12103475_S1_L001_R2_001.fastq.gz
mv SRR12103476_1.fastq.gz SRR12103476_S1_L001_R1_001.fastq.gz
mv SRR12103476_2.fastq.gz SRR12103476_S1_L001_R2_001.fastq.gz

cd ..

Run Cell Ranger

Continue with this step only when the above steps have finished. Run cellranger count:

cellranger count --transcriptome=mm10_H2B-EGFP-30N --id=brain1_str --fastqs=fastq/ --sample=SRR12103475 --sample=SRR12103476 --expect-cells=2299

The --expect-cells parameter is set to the number of cells loaded per well in the 10X chip used for droplet generation (4000 in this case, see the "cells recovered for 10X" column in Suppl. Table 4) divided by 1.74.

Run TREX

With trex installed (as described above), run

trex run10x -o trex_brain1_str brain1_str

Results will be written to a new directory named trex_brain1_str.

Visium

If you want to re-run our experiments on the Visium samples (GSM4644079-GSM4644094), you need to use Space Ranger and a different virus sequence. We used Space Ranger 1.0.0.

You can find the virus sequence in references/pMR526_LV-EF1a-H2B-EGFP-BC.fa in this repository.

This is the association between the GEO sample names and our custom library names listed in Supplementary Table 4:

GEO sample id | Name in Suppl. Tab. 4 -|- GSM4644079 | V9 GSM4644080 | V10 GSM4644081 | V11 GSM4644082 | V12 GSM4644083 | V13 GSM4644084 | V14 GSM4644085 | V15 GSM4644086 | V16 GSM4644087 | amp56 GSM4644088 | amp57 GSM4644089 | amp58 GSM4644090 | amp59 GSM4644091 | amp60 GSM4644092 | amp61 GSM4644093 | amp62 GSM4644094 | amp63

V... are the gene expression libraries and amp... are the libraries targeting the cloneID. There will be only few reads with cloneIDs in the V... libraries.

When analyzing the Space Ranger output with TREX, you need to add --visium to the command. You can also analyze the transcriptome and amplicon data at the same time. For example:

trex run --visium --output trex-V9 --start 1147 --end 1176 --umi-matrix --prefix --visium --samples V9 visium-data/V9 --amplicon visium-data/amp56

Running TREX

The input directory for TREX must be a Cell Ranger output directory. In case of Smart-Seq2 / 3 data, one BAM file with all cells or a folder with one BAM file per cell is expected (see zUMIs output) See the contents of the tests/data/ directory to learn which are the minimum files necessary. Cell Ranger/zUMIs must have been configured to map against a reference augmented by an extra chromosome that contains the cloneID. By default, that extra chromosome is assumed to be the last in the BAM file (use --chromosome to choose a different one). The options -s and -e set where on the extra chromosome the cloneID is located (-s gives start and -e gives end in 1-based coordinates).

Please also run trex run10x --help (or trex smartseq2 --help and trex smartseq3 --help respectively ) to see the other available command-line options.

Pipeline steps overview

This is an overview of the steps that the trex run10x/ trex smartseq3 command performs.

  1. Retrieve usable reads from the input BAM file. A usable read fulfills these requirements:
    • It aligns to the region specified with the --chr, -s and -e flags or, if the flags are not given, to the region that has been automatically identified to be the region containing the variable cloneID sequence,
    • it has both an associated cell ID and UMI (SAM tags CB and UB in case of 10x data , SAM tags BC and UB in case of Smart-seq3 data),
    • its cell ID is included in the list of allowed cell IDs (if such a list is provided with --filter-cellid or -f).
  2. Group reads with identical cell ID and UMI into molecules. The cloneID of the molecule is taken to be the consensus of the cloneIDs.
  3. Error-correct cloneIDs of the molecules.
  4. Group molecules by cell ID into cells.
  5. Filter bad cloneIDs in each cell: Rare cloneIDs also found in another cell are considered to be contaminants. CloneIDs supported by only a single read are removed.
  6. Cluster the cells into clones by creating a clone graph. Edges are drawn between cells that appear to belong to the same clone based on the set Jaccard index threshold. The connected components of the graph are considered to be the clones. (A clone is thus simply a set of cells.)
  7. Error-correct the clone graph by removing spurious edges ("bridges").

trex smartseq2 follows a similar pipeline with the following differences: - A useable read does not require a UMI - Reads do not get grouped into molecules and their cloneIDs are not collapsed and error-corrected into consensus sequences

Input parameters

Jaccard index threshold

The Jaccard index measures the similarity of two sample sets, in this case the similarity of two sets of cloneIDs. It is calculated by dividing the number of overlapping, unique cloneIDs between cell A and B by the total number of unique cloneIDs in cell A and B. An index of 0.0 indicates no overlapping cloneIDs and an index of 1.0 a perfect match. The Jaccard threshold is the Jaccard index above which two cells are merged into one clone. It can be set with the --jaccard-threshold flag and is 0.7 by default, meaning cell A and B are merged into one clone if they have more than 70% of cloneIDs in common.

Filter cellids

Tab-separated file of cell IDs to keep in the TREX run. Adding this file via the --filter-cellid or -f option allows to focus the analysis on specific cells and to filter out low quality cells or doublets. Example:

0 CACTCGTGGTACACACTCCG 1 CACTCGTGGTACCACAAGCA

Filtering cloneIDs

Text file with cloneIDs to ignore. The format is one cloneID per line. Adding this file via the --filter-cloneids option allows to ignore cloneIDs that have been identified as overrepresented or artefactual during library characterization. Example file:

GGTCTCCCTATACCAACAGTATCGTCTCAA GGGTTCTGGGATATTACGTTGACTTGAGAG

Output files

TREX by default writes its results to a newly created directory named trex_run. The name of the output directory can be changed with --output (or -o). The files created in the output directory are described below. They are listed in the order in which the program creates them, see the "Pipeline steps overview" section for more details about what is done in each step.

Many of the files are tables in either tab-separated value (TSV) format or in comma-separated values (CSV) format.

log.txt

This file contains a copy of the output that a TREX run prints to the terminal.

entries.bam

All usable reads from the input BAM file. (See the pipeline steps overview for a description of "usable reads".)

reads.txt

A table listing cell_id, umi and clone_id for each usable input read. Example:

#cell_id          umi         clone_id
TGACGGCGTTACCAGT  AAAAAACTGT  TGTCAATCGTTCGGTTGAGCAAGATCTTAG
  • The character 0 in a cloneIDs signals a deleted base (CIGAR operation D in the input BAM file).
  • If the read does not fully cover the cloneID region, the cloneID contains the character - for each missing base.

molecules.txt

A table listing cell_id, umi and clone_id for each detected molecule. Example:

#cell_id                umi             clone_id
AAACCTGAGAGGTACC        AGTTAAAGTA      TGTCAATCGTTCGGTTGAGCAAGATCTTAG

molecules_corrected.txt

Same as molecules.txt, but after filtering and error correction: - CloneIDs have been error corrected. - Molecules are removed that did not pass filtering criteria (such as low-complexity cloneID filtering).

For the run10x subcommand, this table contains an additional original_clone_id column that shows how the original cloneID before correction.

cells.txt

A table listing the detected cells. The fields are cell_id, a colon (:) and then pairs of columns clone_id1 and count1 for each cloneID found in that cell. Example:

#cell_id          :  clone_id1                       count1  clone_id2 count2  ...
AAACCTGAGAGGTACC  :  TGTCAATCGTTCGGTTGAGCAAGATCTTAG  1
AAACCTGAGTAGCGGT  :  TGTCAATCGTTCGGTTGAGCAAGATCTTAG  3

cells_filtered.txt

The same as cells.txt, but with error-corrected cloneID counts. Cells that end up without any cloneIDs after error correction are removed.

umi_count_matrix.csv

A matrix of UMI counts with cells as columns and cloneIDs as rows. This is a different representation of the data written to cells_filtered.txt.

Only created if option --umi-matrix is used.

read_count_matrix.csv

Instead of UMI count matrix, running trex smartseq2 produces matrix of read counts with cells as columns and cloneIDs as rows. This is a different representation of the data written to cells_filtered.txt.

Only created if option --read-matrix is used.

components.txt

Connected components of the clone graph.

components_corrected.txt

Connected components of the clone graph after error correction.

graph.pdf, graph_corrected.pdf

Plots of the clone graph and the error-corrected clone graph.

These are only created if option --plot is used.

graph_corrected.gv and graph.gv are textual descriptions of the graphs in GraphViz format.

doublets.txt

A list of the cell IDs of the cells that were detected to be doublets.

clones.txt

A table listing the cell IDs belonging to each clone. The columns are clone_id and cell_id where clone_id is a number that identifies the clone.

clone#   cell_id
1        TGGCGCAAGAATAGGG

clone_details.txt

A table listing all clones (a clone is a set of cells), one line per clone. The columns are:

  • clone_nr: A number identifying the clone
  • clone_id: The most common cloneID among all cells in the clone.
  • n_cells: The number of cells in the clone.
  • cloneidsper_cell: The average number of cloneIDs per cell.

The columns are clone# and clone_seq where clone_id is a number that identifies the clone and clone_seq its nucleotide sequence.

clone_nr  clone_id                        n_cells clone_ids_per_cell
1         ACTAGGAGATTGACGGATCACCTTTGGTCG  3       1.00

data.loom

A loom file.

This file is created only if option --loom (or -l) is used.

Creating a quality control report

shell trex qc --plot-jaccard-matrix --plot-hamming-distance DIRECTORY

qc takes as an input the directory (or directories) of trex output. Plotting the jaccard similarity matrix between cells requires some time as jaccard similarity is calculated pairwise amongst all cells. This can be activated adding the optional flag --plot-jaccard-matrix. Hamming distance between all viral cloneIDs found in the dataset after each step can be plotted by means of the optional flag --plot-hamming-distance.

This will add a PDF file named quality_report.pdf describing the quality of the TREX run inside the same folder with the TREX output.

This report contains:

Overall results

  • Histogram of clone sizes
  • Histogram of how many unique cloneIDs can pe found in each clone
  • Histogram of how many unique cloneIDs can be found in each cell
  • (Optional) A histogram of the Jaccard similarity values between cells and a matrix of the Jaccard similarity between all cells.
  • Histogram of how many reads each detected viral cloneID molecule has.

Per step results

Each of these plots has four subplots corresponding to different steps of the TREX pipeline.

  • Histograms of how many nucleotides have been read in each molecule
  • (Optional) Histograms of the Hamming distance between all the viral cloneIDs found
  • Histograms of how many viral cloneID molecules have been found in each cell
  • Histograms of how many molecules of each unique cloneID have been found in the dataset
  • Histograms of How many unique cloneIDs per cell have been found

TREX development

It is highly recommended that you develop TREX within a separate virtual environment:

python3 -m venv --prompt trex .venv
source .venv/bin/activate

Install TREX in "editable" mode:

pip install -e .

Install pre-commit and install the pre-commit hooks (these run at git commit time and do some checks on the to-be-committed files):

pip install pre-commit
pre-commit install

Owner

  • Name: frisen-lab
  • Login: frisen-lab
  • Kind: organization

Citation (CITATION)

Ratz, M., von Berlin, L., Larsson, L. et al.
Clonal relations in the mouse brain revealed by single-cell and spatial transcriptomics.
Nat Neurosci 25, 285–294 (2022).
https://doi.org/10.1038/s41593-022-01011-x

GitHub Events

Total
  • Issues event: 4
  • Watch event: 4
  • Delete event: 3
  • Issue comment event: 14
  • Push event: 6
  • Pull request event: 3
  • Create event: 3
Last Year
  • Issues event: 4
  • Watch event: 4
  • Delete event: 3
  • Issue comment event: 14
  • Push event: 6
  • Pull request event: 3
  • Create event: 3

Issues and Pull Requests

Last synced: 7 months ago

All Time
  • Total issues: 1
  • Total pull requests: 2
  • Average time to close issues: about 1 month
  • Average time to close pull requests: 13 days
  • Total issue authors: 1
  • Total pull request authors: 1
  • Average comments per issue: 1.0
  • Average comments per pull request: 0.0
  • Merged pull requests: 1
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 1
  • Pull requests: 2
  • Average time to close issues: about 1 month
  • Average time to close pull requests: 13 days
  • Issue authors: 1
  • Pull request authors: 1
  • Average comments per issue: 1.0
  • Average comments per pull request: 0.0
  • Merged pull requests: 1
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • acorbat (2)
  • MDLDan (1)
  • dpearton (1)
  • kasperlab (1)
Pull Request Authors
  • marcelm (13)
  • acorbat (2)
  • Leonievb (1)
Top Labels
Issue Labels
Pull Request Labels

Dependencies

.github/workflows/ci.yml actions
  • actions/checkout v3 composite
  • actions/setup-python v4 composite
pyproject.toml pypi
  • loompy *
  • numpy *
  • pandas *
  • pysam *
  • tinyalign *
  • xopen >=0.5.0