CellBarcode

CellBarcode is an R package for dealing with Cellular DNA barcoding sequencing data.

The R package was created by Wenjie SUN, Anne-Marie Lyne, and Leïla Perié at Institut Curie.

Types of barcodes

CellBarcode can handle all types of DNA barcodes, provided that:

• The barcodes have a pattern that can be matched by a regular expression.
• Each barcode is within a single sequencing read.

What you can do with CellBarcode

• Perform quality control for the DNA sequence results, and filter the sequences according to their quality metrics.

• Identify barcode (and UMI) information in sequencing results.

• Performs quality control and deal with the spurious sequences that come from potential PCR & sequence errors.

• Provide toolkits to make it easier to manage samples and barcodes with metadata.

Installing

Install the development version from GitHub

r if(!requireNamespace("remotes", quietly = TRUE)) install.packages("remotes") remotes::install_github("wenjie1991/CellBarcode")

Getting Started

Here is an example of a basic workflow:

```r library(CellBarcode) library(magrittr)

The example data is a mix of MEF lines with known barcodes

2000 reads for each file have been sampled for this test dataset

Data can be accessed here: https://zenodo.org/records/10027002

exampledata <- system.file("extdata", "meftestdata", package = "CellBarcode") fqfiles <- dir(example_data, "gz", full=TRUE)

prepare metadata

metadata <- stringr::strsplitfixed(basename(fqfiles), "", 10)[, c(4, 6)] metadata <- data.frame(metadata) samplename <- apply(metadata, 1, paste, collapse = "") colnames(metadata) = c("cellnumber", "replication") rownames(metadata) = samplename metadata

extract UMI barcode with regular expression

bcobj <- bcextract( fqfiles, pattern = "(.{12})CTCGAGGTCATCGAAGTATCAAG(.+)TAGCAAGCTCGAGAGTAGACCTACT", patterntype = c("UMI" = 1, "barcode" = 2), samplename = samplename, metadata = metadata ) bc_obj

sample subset operation, select 'mixa'

bcsub <- bcsubset(bcobj, sample=replication == "mixa") bcsub

filter the barcode, UMI barcode amplicon >= 2 & UMI counts >= 2

bcsub <- bccureumi(bcsub, depth = 2) %>% bccuredepth(depth = 2)

select barcodes with a white list

bc_sub[c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"), ]

export the barcode counts to data.frame

head(bc2df(bcsub))

export the barcode counts to matrix

head(bc2matrix(bcsub)) ```

License

MIT

Citation

If you use CellBarcode in your research, please cite the following paper: Sun, W. et al. Extracting, filtering and simulating cellular barcodes using CellBarcode tools. Nat Comput Sci 1–16 (2024)