fluentdna

FluentDNA allows you to browse sequence data of any size using a zooming visualization similar to Google Maps. You can use FluentDNA as a standalone program or as a python module for your own bioinformatics projects.

https://github.com/josiahseaman/fluentdna

Science Score: 13.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
  • codemeta.json file
  • .zenodo.json file
  • DOI references
    Found 1 DOI reference(s) in README
  • Academic publication links
  • Committers with academic emails
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (14.4%) to scientific vocabulary

Keywords

alignment bioinformatics bioinformatics-tool chain-alignment ddv dna fasta fasta-sequences fluent fluentdna liftover msa protein sequencing visualization
Last synced: 9 months ago · JSON representation

Repository

FluentDNA allows you to browse sequence data of any size using a zooming visualization similar to Google Maps. You can use FluentDNA as a standalone program or as a python module for your own bioinformatics projects.

Basic Info
  • Host: GitHub
  • Owner: josiahseaman
  • Language: JavaScript
  • Default Branch: python-master
  • Homepage:
  • Size: 71.1 MB
Statistics
  • Stars: 65
  • Watchers: 8
  • Forks: 7
  • Open Issues: 31
  • Releases: 0
Topics
alignment bioinformatics bioinformatics-tool chain-alignment ddv dna fasta fasta-sequences fluent fluentdna liftover msa protein sequencing visualization
Created about 10 years ago · Last pushed almost 5 years ago
Metadata Files
Readme

README.md

FluentDNA Data Visualization Tool

This application creates visualizations of FASTA formatted DNA nucleotide data. FluentDNA generates a DeepZoomImage visualizations similar to Google Maps for FASTA files.

From 2Mbp of Genomic Sequence, FluentDNA generates this image. Changes in nucleotide bias make individual genome elements visible even without an annotation. Add your annotation files to see how they align with the sequence features.
Example FluentDNA output of Human Chr19 2MBp


FluentDNA Quick Start

You can start using FluentDNA: 1. Downloading and unzipping the Latest Release (Mac and Windows only). 2. Open a terminal (command line) in the same folder you unzipped FluentDNA. 3. Run the command ./fluentdna --fasta="FluentDNA/example_data/Human selenoproteins.fa" --runserver 4. Your result files will be placed in the FluentDNA directory FluentDNA/results/. Once your private server has started, all your results are viewable at http://localhost:8000.

FluentDNA can be installed as a python module (required for Linux). See the pip install instructions for more details. pip install --upgrade FluentDNA
Locating Results: You will need to be using the same computer the server is running on. The server will not be visible over network or internet unless your administrator opens the port.


Example Use Cases


Simple FASTA file (DNA)

Generating a basic visualization of a FASTA file downloaded from NCBI or another source is accomplished with the following commands:

Command: ./fluentdna --fasta="FluentDNA/example_data/hg38_chr19_sample.fa" --outname="Test Simple"

This generates an image pyramid with the standard legend (insert image of legend) and nucleotide number display.

Input Data Example: FluentDNA/exampledata/hg38chr19_sample.fa

Result: Hg38 chr19 sample Example FluentDNA output of Human Chr19 2MBp

It is also possible to generate an image file only that can be accessed with an image viewer using --no_webpage.

Command: ./fluentdna --fasta="FluentDNA/example_data/hg38_chr19_sample.fa" --outname="Test Simple" --no_webpage


Multi-part FASTA file (DNA)

Multi-part FASTA format includes multiple sequences in the same file. A sequence record in a FASTA format consists of a single-line description (sequence name), followed by line(s) of sequence data. The first character of the description line is a greater-than (">") symbol. Multi-part format Example: ```

seq0 AATGCCA seq1 GCCCTAT ```

The following command generates a multi-part FASTA file visualization:

Input Data Example: Human Selenoproteins.fa

Command: ./fluentdna --fasta="FluentDNA/example_data/Human selenoproteins.fa"
Result: Human Selenoproteins

This generates a multi-scale image of the multi-part FASTA file. Note that if you don't specify --outname= it will default to the name of the FASTA file.

Using this simple command, FluentDNA can visualize an entire draft genome at once. Result: Ash Tree Genome (Fraxinus excelsior) Fraxinus excelsior genome

Additional options - see also: - --outname - --sort_contigs - --no_titles - --natural_colors - --base_width


Annotated Genomes

By specifying --ref_annotation= you can include a gene annotation to be rendered alongside your sequence. This is currently setup to show gene introns and exons. But the features rendered and colors used can be changed in FluentDNA/Annotations.py

Command: ./fluentdna --fasta="FluentDNA/example_data/gnetum_sample.fa" --ref_annotation="FluentDNA/example_data/Gnetum_sample_genes.gff"

Input Data Example: * Gnetumsamplegenes.gff * Gnetum_sample.fa

Result: Gnetum montanum Annotation Gnetum montanum Annotation

You can download the full Gnetum montanum files from Data Dryad.


Multiple Sequence Alignment Families

To visualize a multiple sequence alignment you need to use the --layout=alignment option to tell FluentDNA to treat each entry in a multipart fasta file as being one row of an alignment. To show many MSAs at once, just point --fasta= to a folder instead of a file.

Input Data Example: * Folder with FA files

Important Note! Make sure there are no other files in your folder besides sequence files. If FluentDNA decides on an unreasonably long "max width" it is because it picked up a non-sequence file in the folder.

Each fasta file represents one aligned protein family. The input fasta file should already be aligned with another program. Each protein is represented by one entry in the fasta file with - inserted for gap characters like this: ```

GeneAinspecies1 ACTCA--ACGATC------GGGT GeneAinspecies2 ACTCAAAACGATCTCTCTAGGGT ```

Command: ./fluentdna --layout=alignment --fasta="FluentDNA/example_data\alignments" --outname="Example 7 Gene Families from Fraxinus"

This generates a multi-scale image of the multiple alignment. The multiple alignment results are sorted by gene name. For a smoother layout use --sort_contigs which will sort them by row count (copy number).

Result: Example 7 Gene Families from Fraxinus

This layout allows users to check thousands of MSAs. Here we used FluentDNA to quality check the merging software for 2,961 putative gene families: Fraxinus Homologous Gene Groups


Alignment of two Genomes

This generates an alignment visualization of two genomes (A and B). Since this is a whole genome alignment the files are very large and not included in the FluentDNA installation. Download each of these files and unzip them into a local folder called data/.

Input Data Download Links (unzip these into data folder):

Command: ./fluentdna --fasta=data/hg38.fa --chainfile=data/hg38ToPanTro5.over.chain --extrafastas data/panTro5.fa --chromosomes chr19 --outname="Human vs Chimpanzee"

This generates a multi-scale image of the alignment. There are 4 columns in this visualization:

  • Column 1. Genome A (gapped entire DNA of genome A)
  • Column 2. Genome A (unique DNA of A)
  • Column 3. Genome B (unique DNA of B)
  • Column 4. Genome B (gapped entire DNA of genome B)

Result: Human vs Chimpanzee_chr19 (natural colors) Rows of sequence side by side Human and chimp.  Gaps where they have unique sequence.

Figure 1 in the paper can be seen at Nucleotide Position 548,505 which corresponds to HG38 chr19:458,731. The difference in coordinates is due to the gaps inserted for sake of alignment.

Note: Whole genome alignment visualizations can be processed in batches, one visualization per chromosome. Simply specify each of the reference chromosomes that you would like to generate. --outname will be used as a prefix for the name of the folder and the visualization. For example, the above command generates a folder called "Human vs Chimpanzee_chr19".


History

This project is a fork of the C# FluentDNA developed at Concordia University. https://github.com/photomedia/DDV/

DDV Licence: https://github.com/photomedia/DDV/blob/master/DDV-license.txt

Support Contact

If you run into any problems or would like to use FluentDNA in research, contact me at josiah@newline.us. I'm happy to support my own software and always interested in new collaborations.

Owner

  • Name: Josiah Seaman
  • Login: josiahseaman
  • Kind: user

GitHub Events

Total
  • Watch event: 3
Last Year
  • Watch event: 3

Committers

Last synced: over 2 years ago

All Time
  • Total Commits: 499
  • Total Committers: 4
  • Avg Commits per committer: 124.75
  • Development Distribution Score (DDS): 0.118
Past Year
  • Commits: 0
  • Committers: 0
  • Avg Commits per committer: 0.0
  • Development Distribution Score (DDS): 0.0
Top Committers
Name Email Commits
Josiah Seaman j****h@n****s 440
Bryan Hurst b****n@n****s 44
Josiah Seaman j****n@g****m 12
Tomasz Neugebauer p****a@g****m 3
Committer Domains (Top 20 + Academic)

Issues and Pull Requests

Last synced: over 2 years ago

All Time
  • Total issues: 82
  • Total pull requests: 13
  • Average time to close issues: 5 months
  • Average time to close pull requests: 1 day
  • Total issue authors: 5
  • Total pull request authors: 1
  • Average comments per issue: 1.3
  • Average comments per pull request: 0.08
  • Merged pull requests: 13
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 1
  • Pull requests: 0
  • Average time to close issues: N/A
  • Average time to close pull requests: N/A
  • Issue authors: 1
  • Pull request authors: 0
  • Average comments per issue: 4.0
  • Average comments per pull request: 0
  • Merged pull requests: 0
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • josiahseaman (74)
  • photomedia (5)
  • BryanHurst (1)
  • aganezov (1)
  • GuyBenzvi (1)
Pull Request Authors
  • josiahseaman (13)
Top Labels
Issue Labels
enhancement (49) bug (11) wontfix (7) documentation (6) help wanted (5) question (3) minor (3)
Pull Request Labels

Packages

  • Total packages: 1
  • Total downloads:
    • pypi 20 last-month
  • Total dependent packages: 0
  • Total dependent repositories: 1
  • Total versions: 3
  • Total maintainers: 1
pypi.org: fluentdna

Visualization tool for bare fasta files. Supports whole genome alignment and multiple sequence alignment.

  • Versions: 3
  • Dependent Packages: 0
  • Dependent Repositories: 1
  • Downloads: 20 Last month
Rankings
Stargazers count: 8.6%
Dependent packages count: 10.0%
Forks count: 12.5%
Average: 18.4%
Dependent repos count: 21.7%
Downloads: 38.9%
Maintainers (1)
Last synced: 9 months ago

Dependencies

setup.py pypi
  • DNASkittleUtils >=
  • Pillow >=3.2.0
  • blist >=1.3.6
  • natsort >=5.1.1
  • numpy >=1.13.3
  • psutil >=5.4.5