Science Score: 23.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
â—‹CITATION.cff file
-
â—‹codemeta.json file
-
â—‹.zenodo.json file
-
✓DOI references
Found 8 DOI reference(s) in README -
â—‹Academic publication links
-
✓Committers with academic emails
1 of 3 committers (33.3%) from academic institutions -
â—‹Institutional organization owner
-
â—‹JOSS paper metadata
-
â—‹Scientific vocabulary similarity
Low similarity (14.2%) to scientific vocabulary
Last synced: 11 months ago
·
JSON representation
Repository
📈 DNA Sequence Visualization for Humans
Basic Info
- Host: GitHub
- Owner: Benjamin-Lee
- License: mit
- Default Branch: master
- Homepage: https://squiggle.readthedocs.io
- Size: 4.21 MB
Statistics
- Stars: 5
- Watchers: 1
- Forks: 0
- Open Issues: 0
- Releases: 0
Fork of IQTLabs/squiggle
Created about 5 years ago
· Last pushed over 5 years ago
https://github.com/Benjamin-Lee/squiggle/blob/master/
[](https://doi.org/10.1093/bioinformatics/bty807) [](https://travis-ci.org/Lab41/squiggle) [](http://squiggle.readthedocs.io/en/latest/?badge=latest) [](https://pypi.org/project/squiggle/) Squiggle is a two-dimensional DNA sequence visualization library that can turn FASTA sequence files like this: >lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB] ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT GCCCTGGCCCACAAGTATCACTAA >lcl|NC_005100.4_cds_NP_150237.1_1 [gene=HBB] ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTTAATGGCCTGTGGGGAAAGGTGAACCCTGATGATG TTGGTGGCGAGGCCCTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGAGGTACTTTGATAGCTTTGG GGACCTGTCCTCTGCCTCTGCTATCATGGGTAACCCTAAGGTGAAGGCCCATGGCAAGAAGGTGATAAAC GCCTTCAATGATGGCCTGAAACACTTGGACAACCTCAAGGGCACCTTTGCTCATCTGAGTGAACTCCACT GTGACAAGCTGCATGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACATGATTGTGATTGTGTTGGGCCA CCACCTGGGCAAGGAATTCTCCCCCTGTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCCAGT GCCCTGGCTCACAAGTACCACTAA into gorgeous, interactive visualizations like this: (Click the picture to view an [interactive version](https://htmlpreview.github.io/?https://github.com/Lab41/squiggle/blob/master/docs/figures/hbb_comparison.html).) ## Installation If you don't have Python 3.5 or greater installed, be sure to [get it](https://www.python.org/downloads/). To get the current stable version of Squiggle, run: $ pip install squiggle Or, alternatively, if you want to get the latest development version: $ pip install git+https://github.com/Lab41/squiggle.git ## Usage Using Squiggle is as easy as: $ squiggle your_sequence.fasta Squiggle has tons of options available to make beautiful, interactive visualizations of DNA sequences. To get a full rundown of the various option, take look at the documentation [here](https://squiggle.readthedocs.io). ## Citation Using Squiggle in your research? Please cite it! - Lee, B. D. (2018). Squiggle: a user-friendly two-dimensional DNA sequence visualization tool. _Bioinformatics_. doi:[10.1093/bioinformatics/bty807](doi.org/10.1093/bioinformatics/bty807) ``` @article{Lee2018, doi = {10.1093/bioinformatics/bty807}, url = {https://doi.org/10.1093/bioinformatics/bty807}, year = {2018}, month = {sep}, publisher = {Oxford University Press ({OUP})}, author = {Benjamin D Lee}, editor = {John Hancock}, title = {Squiggle: a user-friendly two-dimensional {DNA} sequence visualization tool}, journal = {Bioinformatics} } ```
![]()
Owner
- Name: Benjamin Lee
- Login: Benjamin-Lee
- Kind: user
- Location: Tysons, VA
- Website: benjamindlee.com/about
- Repositories: 10
- Profile: https://github.com/Benjamin-Lee
NIH-OxCam scholar at @ncbi & DPhil student at Oxford. Previously @Harvard CS '20 and @IQTLabs
GitHub Events
Total
- Watch event: 1
Last Year
- Watch event: 1
Committers
Last synced: over 3 years ago
All Time
- Total Commits: 183
- Total Committers: 3
- Avg Commits per committer: 61.0
- Development Distribution Score (DDS): 0.027
Top Committers
| Name | Commits | |
|---|---|---|
| Benjamin Lee | b****e@m****m | 178 |
| Matt Shirley | m****5@g****m | 4 |
| Benjamin Lee | b****e@c****u | 1 |
Committer Domains (Top 20 + Academic)
college.harvard.edu: 1
me.com: 1
Issues and Pull Requests
Last synced: over 2 years ago
All Time
- Total issues: 0
- Total pull requests: 0
- Average time to close issues: N/A
- Average time to close pull requests: N/A
- Total issue authors: 0
- Total pull request authors: 0
- Average comments per issue: 0
- Average comments per pull request: 0
- Merged pull requests: 0
- Bot issues: 0
- Bot pull requests: 0
Past Year
- Issues: 0
- Pull requests: 0
- Average time to close issues: N/A
- Average time to close pull requests: N/A
- Issue authors: 0
- Pull request authors: 0
- Average comments per issue: 0
- Average comments per pull request: 0
- Merged pull requests: 0
- Bot issues: 0
- Bot pull requests: 0
Top Authors
Issue Authors
Pull Request Authors
Top Labels
Issue Labels
Pull Request Labels
Packages
- Total packages: 1
-
Total downloads:
- pypi 96 last-month
- Total docker downloads: 317
- Total dependent packages: 0
- Total dependent repositories: 3
- Total versions: 5
- Total maintainers: 1
pypi.org: squiggle
DNA Sequence Visualization for Humans.
- Homepage: https://github.com/Benjamin-Lee/squiggle
- Documentation: https://squiggle.readthedocs.io/
- License: MIT
-
Latest release: 0.3.1
published almost 8 years ago
Rankings
Docker downloads count: 2.4%
Dependent repos count: 9.0%
Dependent packages count: 10.0%
Average: 15.7%
Downloads: 21.2%
Stargazers count: 21.5%
Forks count: 29.8%
Maintainers (1)
Last synced:
11 months ago