pyfaidx

Efficient pythonic random access to fasta subsequences

https://github.com/mdshw5/pyfaidx

Science Score: 49.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
    Found 3 DOI reference(s) in README
  • Academic publication links
  • Committers with academic emails
    6 of 38 committers (15.8%) from academic institutions
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (13.2%) to scientific vocabulary

Keywords

bgzf bioinformatics dna fasta genomics indexing protein python samtools

Keywords from Contributors

bioconda sequence-alignment protein-structure phylogenetics vizualisation seqera reporting quality-control pypi multiqc
Last synced: 7 months ago · JSON representation

Repository

Efficient pythonic random access to fasta subsequences

Basic Info
Statistics
  • Stars: 479
  • Watchers: 8
  • Forks: 76
  • Open Issues: 2
  • Releases: 83
Topics
bgzf bioinformatics dna fasta genomics indexing protein python samtools
Created over 12 years ago · Last pushed 7 months ago
Metadata Files
Readme License Code of conduct

README.rst

|CI| |Package| |PyPI| |Coverage| |Downloads|

Description
-----------

Samtools provides a function "faidx" (FAsta InDeX), which creates a
small flat index file ".fai" allowing for fast random access to any
subsequence in the indexed FASTA file, while loading a minimal amount of the
file in to memory. This python module implements pure Python classes for
indexing, retrieval, and in-place modification of FASTA files using a samtools
compatible index. The pyfaidx module is API compatible with the `pygr`_ seqdb module.
A command-line script "`faidx`_" is installed alongside the pyfaidx module, and
facilitates complex manipulation of FASTA files without any programming knowledge.

.. _`pygr`: https://github.com/cjlee112/pygr

If you use pyfaidx in your publication, please cite:

`Shirley MD`_, `Ma Z`_, `Pedersen B`_, `Wheelan S`_. `Efficient "pythonic" access to FASTA files using pyfaidx `_. PeerJ PrePrints 3:e1196. 2015.

.. _`Shirley MD`: http://github.com/mdshw5
.. _`Ma Z`: http://github.com/azalea
.. _`Pedersen B`: http://github.com/brentp
.. _`Wheelan S`: http://github.com/swheelan

Installation
------------

This package is tested under Linux and macOS using Python 3.7+, and and is available from the PyPI:

::

    pip install pyfaidx  # add --user if you don't have root

or download a `release `_ and:

::

    pip install .

If using ``pip install --user`` make sure to add ``/home/$USER/.local/bin`` to your ``$PATH`` (on linux) or ``/Users/$USER/Library/Python/{python version}/bin`` (on macOS) if you want to run the ``faidx`` script.

Python 2.6 and 2.7 users may choose to use a package version from `v0.7.2 `_ or earier.

Usage
-----

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta')
    >>> genes
    Fasta("tests/data/genes.fasta")  # set strict_bounds=True for bounds checking

Acts like a dictionary.

.. code:: python

    >>> genes.keys()
    ('AB821309.1', 'KF435150.1', 'KF435149.1', 'NR_104216.1', 'NR_104215.1', 'NR_104212.1', 'NM_001282545.1', 'NM_001282543.1', 'NM_000465.3', 'NM_001282549.1', 'NM_001282548.1', 'XM_005249645.1', 'XM_005249644.1', 'XM_005249643.1', 'XM_005249642.1', 'XM_005265508.1', 'XM_005265507.1', 'XR_241081.1', 'XR_241080.1', 'XR_241079.1')

    >>> genes['NM_001282543.1'][200:230]
    >NM_001282543.1:201-230
    CTCGTTCCGCGCCCGCCATGGAACCGGATG

    >>> genes['NM_001282543.1'][200:230].seq
    'CTCGTTCCGCGCCCGCCATGGAACCGGATG'

    >>> genes['NM_001282543.1'][200:230].name
    'NM_001282543.1'

    # Start attributes are 1-based
    >>> genes['NM_001282543.1'][200:230].start
    201

    # End attributes are 0-based
    >>> genes['NM_001282543.1'][200:230].end
    230

    >>> genes['NM_001282543.1'][200:230].fancy_name
    'NM_001282543.1:201-230'

    >>> len(genes['NM_001282543.1'])
    5466

Note that start and end coordinates of Sequence objects are [1, 0]. This can be changed to [0, 0] by passing ``one_based_attributes=False`` to ``Fasta`` or ``Faidx``. This argument only affects the ``Sequence .start/.end`` attributes, and has no effect on slicing coordinates.

Indexes like a list:

.. code:: python

    >>> genes[0][:50]
    >AB821309.1:1-50
    ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAAC

Slices just like a string:

.. code:: python

    >>> genes['NM_001282543.1'][200:230][:10]
    >NM_001282543.1:201-210
    CTCGTTCCGC

    >>> genes['NM_001282543.1'][200:230][::-1]
    >NM_001282543.1:230-201
    GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

    >>> genes['NM_001282543.1'][200:230][::3]
    >NM_001282543.1:201-230
    CGCCCCTACA

    >>> genes['NM_001282543.1'][:]
    >NM_001282543.1:1-5466
    CCCCGCCCCT........

- Slicing start and end coordinates are 0-based, just like Python sequences.

Complements and reverse complements just like DNA

.. code:: python

    >>> genes['NM_001282543.1'][200:230].complement
    >NM_001282543.1 (complement):201-230
    GAGCAAGGCGCGGGCGGTACCTTGGCCTAC

    >>> genes['NM_001282543.1'][200:230].reverse
    >NM_001282543.1:230-201
    GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

    >>> -genes['NM_001282543.1'][200:230]
    >NM_001282543.1 (complement):230-201
    CATCCGGTTCCATGGCGGGCGCGGAACGAG

``Fasta`` objects can also be accessed using method calls:

.. code:: python

    >>> genes.get_seq('NM_001282543.1', 201, 210)
    >NM_001282543.1:201-210
    CTCGTTCCGC

    >>> genes.get_seq('NM_001282543.1', 201, 210, rc=True)
    >NM_001282543.1 (complement):210-201
    GCGGAACGAG

Spliced sequences can be retrieved from a list of [start, end] coordinates:
**TODO** update this section

.. code:: python

    # new in v0.5.1
    segments = [[1, 10], [50, 70]]
    >>> genes.get_spliced_seq('NM_001282543.1', segments)
    >gi|543583786|ref|NM_001282543.1|:1-70
    CCCCGCCCCTGGTTTCGAGTCGCTGGCCTGC

.. _keyfn:

Custom key functions provide cleaner access:

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
    >>> genes.keys()
    dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
    >>> genes['NR_104212'][:10]
    >NR_104212:1-10
    CCCCGCCCCT

You can specify a character to split names on, which will generate additional entries:

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', split_char='.', duplicate_action="first") # default duplicate_action="stop"
    >>> genes.keys()
    dict_keys(['.1', 'NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])

If your `key_function` or `split_char` generates duplicate entries, you can choose what action to take:

.. code:: python

    # new in v0.4.9
    >>> genes = Fasta('tests/data/genes.fasta', split_char="|", duplicate_action="longest")
    >>> genes.keys()
    dict_keys(['gi', '563317589', 'dbj', 'AB821309.1', '', '557361099', 'gb', 'KF435150.1', '557361097', 'KF435149.1', '543583796', 'ref', 'NR_104216.1', '543583795', 'NR_104215.1', '543583794', 'NR_104212.1', '543583788', 'NM_001282545.1', '543583786', 'NM_001282543.1', '543583785', 'NM_000465.3', '543583740', 'NM_001282549.1', '543583738', 'NM_001282548.1', '530384540', 'XM_005249645.1', '530384538', 'XM_005249644.1', '530384536', 'XM_005249643.1', '530384534', 'XM_005249642.1', '530373237','XM_005265508.1', '530373235', 'XM_005265507.1', '530364726', 'XR_241081.1', '530364725', 'XR_241080.1', '530364724', 'XR_241079.1'])

Filter functions (returning True) limit the index:

.. code:: python

    # new in v0.3.8
    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', filt_function = lambda x: x[0] == 'N')
    >>> genes.keys()
    dict_keys(['NR_104212', 'NM_001282543', 'NR_104216', 'NR_104215', 'NM_001282549', 'NM_000465', 'NM_001282545', 'NM_001282548'])
    >>> genes['XM_005249644']
    KeyError: XM_005249644 not in tests/data/genes.fasta.

Or just get a Python string:

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', as_raw=True)
    >>> genes
    Fasta("tests/data/genes.fasta", as_raw=True)

    >>> genes['NM_001282543.1'][200:230]
    CTCGTTCCGCGCCCGCCATGGAACCGGATG

You can make sure that you always receive an uppercase sequence, even if your fasta file has lower case

.. code:: python

    >>> from pyfaidx import Fasta
    >>> reference = Fasta('tests/data/genes.fasta.lower', sequence_always_upper=True)
    >>> reference['gi|557361099|gb|KF435150.1|'][1:70]

    >gi|557361099|gb|KF435150.1|:2-70
    TGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAA


You can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:

.. code:: python

    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta')
    >>> for line in genes['NM_001282543.1']:
    ...   print(line)
    CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
    AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
    CGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGC
    ...

Sequence names are truncated on any whitespace. This is a limitation of the indexing strategy. However, full names can be recovered:

.. code:: python

    # new in v0.3.7
    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta')
    >>> for record in genes:
    ...   print(record.name)
    ...   print(record.long_name)
    ...
    gi|563317589|dbj|AB821309.1|
    gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds
    gi|557361099|gb|KF435150.1|
    gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced
    gi|557361097|gb|KF435149.1|
    gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds
    ...

    # new in v0.4.9
    >>> from pyfaidx import Fasta
    >>> genes = Fasta('tests/data/genes.fasta', read_long_names=True)
    >>> for record in genes:
    ...   print(record.name)
    ...
    gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds
    gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced
    gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds

Records can be accessed efficiently as numpy arrays:

.. code:: python

    # new in v0.5.4
    >>> from pyfaidx import Fasta
    >>> import numpy as np
    >>> genes = Fasta('tests/data/genes.fasta')
    >>> np.asarray(genes['NM_001282543.1'])
    array(['C', 'C', 'C', ..., 'A', 'A', 'A'], dtype='|S1')

Sequence can be buffered in memory using a read-ahead buffer
for fast sequential access:

.. code:: python

    >>> from timeit import timeit
    >>> fetch = "genes['NM_001282543.1'][200:230]"
    >>> read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta', read_ahead=10000)"
    >>> no_read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta')"
    >>> string_slicing = "genes = {}; genes['NM_001282543.1'] = 'N'*10000"

    >>> timeit(fetch, no_read_ahead, number=10000)
    0.2204863309962093
    >>> timeit(fetch, read_ahead, number=10000)
    0.1121859749982832
    >>> timeit(fetch, string_slicing, number=10000)
    0.0033553699977346696

Read-ahead buffering can reduce runtime by 1/2 for sequential accesses to buffered regions.

.. role:: red

If you want to modify the contents of your FASTA file in-place, you can use the `mutable` argument.
Any portion of the FastaRecord can be replaced with an equivalent-length string.
:red:`Warning`: *This will change the contents of your file immediately and permanently:*

.. code:: python

    >>> genes = Fasta('tests/data/genes.fasta', mutable=True)
    >>> type(genes['NM_001282543.1'])
    

    >>> genes['NM_001282543.1'][:10]
    >NM_001282543.1:1-10
    CCCCGCCCCT
    >>> genes['NM_001282543.1'][:10] = 'NNNNNNNNNN'
    >>> genes['NM_001282543.1'][:15]
    >NM_001282543.1:1-15
    NNNNNNNNNNCTGGC

The FastaVariant class provides a way to integrate single nucleotide variant calls to generate a consensus sequence.

.. code:: python

    # new in v0.4.0
    >>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', het=True, hom=True)
    RuntimeWarning: Using sample NA06984 genotypes.

    >>> consensus['22'].variant_sites
    (16042793, 21833121, 29153196, 29187373, 29187448, 29194610, 29821295, 29821332, 29993842, 32330460, 32352284)

    >>> consensus['22'][16042790:16042800]
    >22:16042791-16042800
    TCGTAGGACA

    >>> Fasta('tests/data/chr22.fasta')['22'][16042790:16042800]
    >22:16042791-16042800
    TCATAGGACA

    >>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', sample='NA06984', het=True, hom=True, call_filter='GT == "0/1"')
    >>> consensus['22'].variant_sites
    (16042793, 29187373, 29187448, 29194610, 29821332)
    
You can also specify paths using ``pathlib.Path`` objects.

.. code:: python
    
    #new in v0.7.1
    >>> from pyfaidx import Fasta
    >>> from pathlib import Path
    >>> genes = Fasta(Path('tests/data/genes.fasta'))
    >>> genes
    Fasta("tests/data/genes.fasta")

Accessing fasta files from `filesystem_spec `_ filesystems:

.. code:: python

    # new in v0.7.0
    # pip install fsspec s3fs
    >>> import fsspec
    >>> from pyfaidx import Fasta
    >>> of = fsspec.open("s3://broad-references/hg19/v0/Homo_sapiens_assembly19.fasta", anon=True)
    >>> genes = Fasta(of)


.. _faidx:

It also provides a command-line script:

cli script: faidx
~~~~~~~~~~~~~~~~~

.. code:: bash

    Fetch sequences from FASTA. If no regions are specified, all entries in the
    input file are returned. Input FASTA file must be consistently line-wrapped,
    and line wrapping of output is based on input line lengths.

    positional arguments:
      fasta                 FASTA file
      regions               space separated regions of sequence to fetch e.g.
                            chr1:1-1000

    optional arguments:
      -h, --help            show this help message and exit
      -b BED, --bed BED     bed file of regions (zero-based start coordinate)
      -o OUT, --out OUT     output file name (default: stdout)
      -i {bed,chromsizes,nucleotide,transposed}, --transform {bed,chromsizes,nucleotide,transposed} transform the requested regions into another format. default: None
      -c, --complement      complement the sequence. default: False
      -r, --reverse         reverse the sequence. default: False
      -a SIZE_RANGE, --size-range SIZE_RANGE
                            selected sequences are in the size range [low, high]. example: 1,1000 default: None
      -n, --no-names        omit sequence names from output. default: False
      -f, --full-names      output full names including description. default: False
      -x, --split-files     write each region to a separate file (names are derived from regions)
      -l, --lazy            fill in --default-seq for missing ranges. default: False
      -s DEFAULT_SEQ, --default-seq DEFAULT_SEQ
                            default base for missing positions and masking. default: None
      -d DELIMITER, --delimiter DELIMITER
                            delimiter for splitting names to multiple values (duplicate names will be discarded). default: None
      -e HEADER_FUNCTION, --header-function HEADER_FUNCTION
                            python function to modify header lines e.g: "lambda x: x.split("|")[0]". default: lambda x: x.split()[0]
      -u {stop,first,last,longest,shortest}, --duplicates-action {stop,first,last,longest,shortest}
                            entry to take when duplicate sequence names are encountered. default: stop
      -g REGEX, --regex REGEX
                            selected sequences are those matching regular expression. default: .*
      -v, --invert-match    selected sequences are those not matching 'regions' argument. default: False
      -m, --mask-with-default-seq
                            mask the FASTA file using --default-seq default: False
      -M, --mask-by-case    mask the FASTA file by changing to lowercase. default: False
      -e HEADER_FUNCTION, --header-function HEADER_FUNCTION
                            python function to modify header lines e.g: "lambda x: x.split("|")[0]". default: None
      --no-rebuild          do not rebuild the .fai index even if it is out of date. default: False
      --version             print pyfaidx version number

Examples:

.. code:: bash

    $ faidx -v tests/data/genes.fasta
    ### Creates an .fai index, but supresses sequence output using --invert-match ###

    $ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
    >NM_001282543.1:201-210
    CTCGTTCCGC
    >NM_001282543.1:300-320
    GTAATTGTGTAAGTGACTGCA

    $ faidx --full-names tests/data/genes.fasta NM_001282543.1:201-210
    >NM_001282543.1| Homo sapiens BRCA1 associated RING domain 1 (BARD1), transcript variant 2, mRNA
    CTCGTTCCGC

    $ faidx --no-names tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
    CTCGTTCCGC
    GTAATTGTGTAAGTGACTGCA

    $ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
    >NM_001282543.1:201-210 (complement)
    GAGCAAGGCG

    $ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
    >NM_001282543.1:210-201
    CGCCTTGCTC

    $ faidx --reverse --complement tests/data/genes.fasta NM_001282543.1:201-210
    >NM_001282543.1:210-201 (complement)
    GCGGAACGAG

    $ faidx tests/data/genes.fasta NM_001282543.1
    >NM_001282543.1:1-5466
    CCCCGCCCCT........
    ..................
    ..................
    ..................

    $ faidx --regex "^NM_00128254[35]" genes.fasta
    >NM_001282543.1
    ..................
    ..................
    ..................
    >NM_001282545.1
    ..................
    ..................
    ..................

    $ faidx --lazy tests/data/genes.fasta NM_001282543.1:5460-5480
    >NM_001282543.1:5460-5480
    AAAAAAANNNNNNNNNNNNNN

    $ faidx --lazy --default-seq='Q' tests/data/genes.fasta NM_001282543.1:5460-5480
    >NM_001282543.1:5460-5480
    AAAAAAAQQQQQQQQQQQQQQ

    $ faidx tests/data/genes.fasta --bed regions.bed
    ...

    $ faidx --transform chromsizes tests/data/genes.fasta
    AB821309.1	3510
    KF435150.1	481
    KF435149.1	642
    NR_104216.1	4573
    NR_104215.1	5317
    NR_104212.1	5374
    ...

    $ faidx --transform bed tests/data/genes.fasta
    AB821309.1	1    3510
    KF435150.1	1    481
    KF435149.1	1    642
    NR_104216.1	1   4573
    NR_104215.1	1   5317
    NR_104212.1	1   5374
    ...

    $ faidx --transform nucleotide tests/data/genes.fasta
    name	start	end	A	T	C	G	N
    AB821309.1	1	3510	955	774	837	944	0
    KF435150.1	1	481	149	120	103	109	0
    KF435149.1	1	642	201	163	129	149	0
    NR_104216.1	1	4573	1294	1552	828	899	0
    NR_104215.1	1	5317	1567	1738	968	1044	0
    NR_104212.1	1	5374	1581	1756	977	1060	0
    ...

    faidx --transform transposed tests/data/genes.fasta
    AB821309.1	1	3510	ATGGTCAGCTGGGGTCGTTTCATC...
    KF435150.1	1	481	ATGACATCATTTTCCACCTCTGCT...
    KF435149.1	1	642	ATGACATCATTTTCCACCTCTGCT...
    NR_104216.1	1	4573	CCCCGCCCCTCTGGCGGCCCGCCG...
    NR_104215.1	1	5317	CCCCGCCCCTCTGGCGGCCCGCCG...
    NR_104212.1	1	5374	CCCCGCCCCTCTGGCGGCCCGCCG...
    ...

    $ faidx --split-files tests/data/genes.fasta
    $ ls
    AB821309.1.fasta	NM_001282549.1.fasta	XM_005249645.1.fasta
    KF435149.1.fasta	NR_104212.1.fasta	XM_005265507.1.fasta
    KF435150.1.fasta	NR_104215.1.fasta	XM_005265508.1.fasta
    NM_000465.3.fasta	NR_104216.1.fasta	XR_241079.1.fasta
    NM_001282543.1.fasta	XM_005249642.1.fasta	XR_241080.1.fasta
    NM_001282545.1.fasta	XM_005249643.1.fasta	XR_241081.1.fasta
    NM_001282548.1.fasta	XM_005249644.1.fasta

    $ faidx --delimiter='_' tests/data/genes.fasta 000465.3
    >000465.3
    CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
    AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
    .......

    $ faidx --size-range 5500,6000 -i chromsizes tests/data/genes.fasta
    NM_000465.3	5523

    $ faidx -m --bed regions.bed tests/data/genes.fasta
    ### Modifies tests/data/genes.fasta by masking regions using --default-seq character ###

    $ faidx -M --bed regions.bed tests/data/genes.fasta
    ### Modifies tests/data/genes.fasta by masking regions using lowercase characters ###

    $ faidx -e "lambda x: x.split('.')[0]" tests/data/genes.fasta -i bed
    AB821309	1	3510
    KF435150	1	481
    KF435149	1	642
    NR_104216	1	4573
    NR_104215	1	5317
    .......


Similar syntax as ``samtools faidx``


A lower-level Faidx class is also available:

.. code:: python

    >>> from pyfaidx import Faidx
    >>> fa = Faidx('genes.fa')  # can return str with as_raw=True
    >>> fa.index
    OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])

    >>> fa.index['AB821309.1'].rlen
    3510

    fa.fetch('AB821309.1', 1, 10)  # these are 1-based genomic coordinates
    >AB821309.1:1-10
    ATGGTCAGCT


-  If the FASTA file is not indexed, when ``Faidx`` is initialized the
   ``build_index`` method will automatically run, and
   the index will be written to "filename.fa.fai" with ``write_fai()``.
   where "filename.fa" is the original FASTA file.
-  Start and end coordinates are 1-based.

Support for compressed FASTA
----------------------------

``pyfaidx`` can create and read ``.fai`` indices for FASTA files that have
been compressed using the `bgzip `_
tool from `samtools `_. ``bgzip`` writes compressed
data in a ``BGZF`` format. ``BGZF`` is ``gzip`` compatible, consisting of
multiple concatenated ``gzip`` blocks, each with an additional ``gzip``
header making it possible to build an index for rapid random access. I.e.,
files compressed with ``bgzip`` are valid ``gzip`` and so can be read by
``gunzip``.  See `this description
`_ for more details on
``bgzip``.

Changelog
---------

Please see the `releases `_ for a
comprehensive list of version changes.

Known issues
------------

I try to fix as many bugs as possible, but most of this work is supported by a single developer. Please check the `known issues `_ for bugs relevant to your work. Pull requests are welcome.


Contributing
------------

Create a new Pull Request with one feature. If you add a new feature, please
create also the relevant test.

To get test running on your machine:
 - Create a new virtualenv and install the `dev-requirements.txt`.
 
      pip install -r dev-requirements.txt
      
 - Download the test data running:

      python tests/data/download_gene_fasta.py

 - Run the tests with

      pytests

Acknowledgements
----------------

This project is freely licensed by the author, `Matthew
Shirley `_, and was completed under the
mentorship and financial support of Drs. `Sarah
Wheelan `_ and `Vasan
Yegnasubramanian `_ at the Sidney Kimmel
Comprehensive Cancer Center in the Department of Oncology.

.. |Travis| image:: https://travis-ci.com/mdshw5/pyfaidx.svg?branch=master
    :target: https://travis-ci.com/mdshw5/pyfaidx
    
.. |CI| image:: https://github.com/mdshw5/pyfaidx/actions/workflows/main.yml/badge.svg?branch=master
    :target: https://github.com/mdshw5/pyfaidx/actions/workflows/main.yml

.. |PyPI| image:: https://img.shields.io/pypi/v/pyfaidx.svg?branch=master
    :target: https://pypi.python.org/pypi/pyfaidx

.. |Landscape| image:: https://landscape.io/github/mdshw5/pyfaidx/master/landscape.svg
   :target: https://landscape.io/github/mdshw5/pyfaidx/master
   :alt: Code Health

.. |Coverage| image:: https://codecov.io/gh/mdshw5/pyfaidx/branch/master/graph/badge.svg
   :target: https://codecov.io/gh/mdshw5/pyfaidx

.. |Depsy| image:: http://depsy.org/api/package/pypi/pyfaidx/badge.svg
   :target: http://depsy.org/package/python/pyfaidx

.. |Appveyor| image:: https://ci.appveyor.com/api/projects/status/80ihlw30a003596w?svg=true
   :target: https://ci.appveyor.com/project/mdshw5/pyfaidx
   
.. |Package| image:: https://github.com/mdshw5/pyfaidx/actions/workflows/pypi.yml/badge.svg
   :target: https://github.com/mdshw5/pyfaidx/actions/workflows/pypi.yml
   
.. |Downloads| image:: https://img.shields.io/pypi/dm/pyfaidx.svg
   :target: https://pypi.python.org/pypi/pyfaidx/

Owner

  • Name: Matt Shirley
  • Login: mdshw5
  • Kind: user
  • Location: Boston, MA
  • Company: @novartis

Data Scientist @Novartis, CSO Sturge-Weber Foundation. Oncology and Rare Disease Research matt_d.shirley@novartis.com

GitHub Events

Total
  • Create event: 8
  • Release event: 4
  • Issues event: 9
  • Watch event: 25
  • Delete event: 8
  • Issue comment event: 17
  • Push event: 9
  • Pull request event: 11
  • Fork event: 1
Last Year
  • Create event: 8
  • Release event: 4
  • Issues event: 9
  • Watch event: 25
  • Delete event: 8
  • Issue comment event: 17
  • Push event: 9
  • Pull request event: 11
  • Fork event: 1

Committers

Last synced: about 1 year ago

All Time
  • Total Commits: 795
  • Total Committers: 38
  • Avg Commits per committer: 20.921
  • Development Distribution Score (DDS): 0.136
Past Year
  • Commits: 12
  • Committers: 3
  • Avg Commits per committer: 4.0
  • Development Distribution Score (DDS): 0.167
Top Committers
Name Email Commits
Matt Shirley m****5@g****m 687
Andreas Poehlmann a****s@p****o 10
Lucille Delisle l****e@e****h 10
Douglas Hauge D****e@b****m 8
terrycojones t****y@j****s 8
Michele Mattioni m****i@g****m 7
Bardia-Masudy b****4@g****m 7
Marcel Martin m****n@s****e 6
Brent Pedersen b****e@g****m 6
Maarten van der Sande m****e@h****m 5
David Palao d****o@g****m 4
azalea m****g@g****m 4
simonvh s****n@g****m 3
Erik Clarke e****l@m****u 2
Alexandre Detiste a****e@g****m 2
Michael Barton m****l@m****k 2
Tobias Sargeant t****s@g****m 2
Étienne Mollier e****r@d****g 2
Tim O'Donnell t****l@g****m 1
Siebren Frölich 4****f 1
Julian de Ruiter j****r@g****m 1
Matt Shirley m****t@c****l 1
Svein Tore Koksrud Seljebotn s****n@m****o 1
Ryan Dale r****e@n****v 1
Roman Feldbauer s****i@f****g 1
Nezar n****r@g****m 1
Mathias Walter m****s@w****d 1
Kwat K****E 1
Joris Cadow j****w@g****m 1
Johannes Köster j****r@u****e 1
and 8 more...

Issues and Pull Requests

Last synced: 7 months ago

All Time
  • Total issues: 67
  • Total pull requests: 67
  • Average time to close issues: 11 months
  • Average time to close pull requests: about 1 month
  • Total issue authors: 49
  • Total pull request authors: 29
  • Average comments per issue: 3.24
  • Average comments per pull request: 1.82
  • Merged pull requests: 57
  • Bot issues: 0
  • Bot pull requests: 1
Past Year
  • Issues: 4
  • Pull requests: 13
  • Average time to close issues: about 24 hours
  • Average time to close pull requests: about 11 hours
  • Issue authors: 4
  • Pull request authors: 5
  • Average comments per issue: 1.5
  • Average comments per pull request: 1.0
  • Merged pull requests: 9
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • mdshw5 (10)
  • Benjamin-Lee (3)
  • KwatMDPhD (3)
  • dhauge (3)
  • openpaul (2)
  • marco-mariotti (2)
  • palao (2)
  • chtsai0105 (1)
  • larahurban (1)
  • dburkhardt (1)
  • VidJa (1)
  • aswarren (1)
  • arivers (1)
  • lldelisle (1)
  • kubu4 (1)
Pull Request Authors
  • mdshw5 (28)
  • a-detiste (4)
  • emollier (3)
  • ap-- (3)
  • rraadd88 (2)
  • marcelm (2)
  • Maarten-vd-Sande (2)
  • eroller (2)
  • ggydush (1)
  • KwatMDPhD (1)
  • y9c (1)
  • jvierstra (1)
  • hsiaoyi0504 (1)
  • prihoda (1)
  • dependabot[bot] (1)
Top Labels
Issue Labels
enhancement (12) bug (7) help-wanted (6) question (3) testing (3) wontfix (2) known (2) investigating (1) might do (1)
Pull Request Labels
enhancement (7) testing (1) dependencies (1)

Packages

  • Total packages: 2
  • Total downloads:
    • pypi 456,904 last-month
  • Total docker downloads: 56,430
  • Total dependent packages: 76
    (may contain duplicates)
  • Total dependent repositories: 268
    (may contain duplicates)
  • Total versions: 155
  • Total maintainers: 1
pypi.org: pyfaidx

pyfaidx: efficient pythonic random access to fasta subsequences

  • Versions: 96
  • Dependent Packages: 76
  • Dependent Repositories: 268
  • Downloads: 456,904 Last month
  • Docker Downloads: 56,430
Rankings
Dependent packages count: 0.2%
Docker downloads count: 0.8%
Dependent repos count: 0.9%
Downloads: 1.1%
Average: 1.9%
Stargazers count: 3.2%
Forks count: 5.2%
Maintainers (1)
Last synced: 7 months ago
proxy.golang.org: github.com/mdshw5/pyfaidx
  • Versions: 59
  • Dependent Packages: 0
  • Dependent Repositories: 0
Rankings
Dependent packages count: 9.0%
Average: 9.6%
Dependent repos count: 10.2%
Last synced: 7 months ago

Dependencies

dev-requirements.txt pypi
  • biopython * development
  • coverage * development
  • cython * development
  • fsspec * development
  • mock * development
  • numpy * development
  • pyfasta * development
  • pysam * development
  • pytest * development
  • pytest-cov * development
  • pyvcf3 * development
  • requests * development
  • setuptools * development
  • six * development
.github/workflows/main.yml actions
  • actions/cache v3.0.11 composite
  • actions/checkout v3.1.0 composite
  • actions/setup-python v4.3.0 composite
  • codecov/codecov-action v3.1.1 composite
.github/workflows/pypi.yml actions
  • actions/checkout v3 composite
  • actions/setup-python v4 composite
  • pypa/gh-action-pypi-publish v1 composite
pyproject.toml pypi
  • setuptools *
  • six *