fuzzysearch
Find parts of long text or data, allowing for some changes/typos.
Science Score: 13.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
○CITATION.cff file
-
✓codemeta.json file
Found codemeta.json file -
○.zenodo.json file
-
○DOI references
-
○Academic publication links
-
○Committers with academic emails
-
○Institutional organization owner
-
○JOSS paper metadata
-
○Scientific vocabulary similarity
Low similarity (13.5%) to scientific vocabulary
Keywords
fuzzy-matching
fuzzy-search
python
string-search
text-search
Last synced: 6 months ago
·
JSON representation
Repository
Find parts of long text or data, allowing for some changes/typos.
Basic Info
Statistics
- Stars: 328
- Watchers: 7
- Forks: 25
- Open Issues: 10
- Releases: 9
Topics
fuzzy-matching
fuzzy-search
python
string-search
text-search
Created over 12 years ago
· Last pushed 9 months ago
Metadata Files
Readme
Changelog
Contributing
License
Authors
README.rst
===========
fuzzysearch
===========
.. image:: https://img.shields.io/pypi/v/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Latest Version
.. image:: https://img.shields.io/coveralls/taleinat/fuzzysearch.svg?branch=master
:target: https://coveralls.io/r/taleinat/fuzzysearch?branch=master
:alt: Test Coverage
.. image:: https://img.shields.io/pypi/wheel/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Wheels
.. image:: https://img.shields.io/pypi/pyversions/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Supported Python versions
.. image:: https://img.shields.io/pypi/implementation/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch
:alt: Supported Python implementations
.. image:: https://img.shields.io/pypi/l/fuzzysearch.svg?style=flat
:target: https://pypi.python.org/pypi/fuzzysearch/
:alt: License
Fuzzy search: Find parts of long text or data, allowing for some
changes/typos.
Highly optimized, simple to use, does one thing well.
.. code:: python
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
* Two simple functions to use: one for in-memory data and one for files
* Fastest search algorithm is chosen automatically
* Levenshtein Distance metric with configurable parameters
* Separately configure the max. allowed distance, substitutions, deletions
and/or insertions
* Advanced algorithms with optional C and Cython optimizations
* Properly handles Unicode; special optimizations for binary data
* Simple installation:
* ``pip install fuzzysearch`` just works
* pure-Python fallbacks for compiled modules
* only one dependency (``attrs``)
* Extensively tested
* Free software: `MIT license `_
For more info, see the `documentation `_.
How is this different than FuzzyWuzzy or RapidFuzz?
---------------------------------------------------
The main difference is that fuzzysearch searches for fuzzy matches through
long texts or data. FuzzyWuzzy and RapidFuzz, on the other hand, are intended
for fuzzy comparison of pairs of strings, identifying how closely they match
according to some metric such as the Levenshtein distance.
These are very different use-cases, and the solutions are very different as
well.
How is this different than ElasticSearch and Lucene?
----------------------------------------------------
The main difference is that fuzzysearch does no indexing or other
preparations; it directly searches through the given text or data for a given
sub-string. Therefore, it is much simpler to use compared to systems based on
text indexing.
Installation
------------
``fuzzysearch`` supports Python versions 3.8+, as well as PyPy 3.9 and 3.10.
.. code::
$ pip install fuzzysearch
This will work even if installing the C and Cython extensions fails, using
pure-Python fallbacks.
Usage
-----
Just call ``find_near_matches()`` with the sub-sequence you're looking for,
the sequence to search, and the matching parameters:
.. code:: python
>>> from fuzzysearch import find_near_matches
# search for 'PATTERN' with a maximum Levenshtein Distance of 1
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
To search in a file, use ``find_near_matches_in_file()``:
.. code:: python
>>> from fuzzysearch import find_near_matches_in_file
>>> with open('data_file', 'rb') as f:
... find_near_matches_in_file(b'PATTERN', f, max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
Examples
--------
*fuzzysearch* is great for ad-hoc searches of genetic data, such as DNA or
protein sequences, before reaching for more complex tools:
.. code:: python
>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' # distance = 1
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1, matched="TAGCACTGTAGGGATAACAAT")]
BioPython sequences are also supported:
.. code:: python
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> sequence = Seq('''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG''', IUPAC.unambiguous_dna)
>>> subsequence = Seq('TGCACTGTAGGGATAACAAT', IUPAC.unambiguous_dna)
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1, matched="TAGCACTGTAGGGATAACAAT")]
Matching Criteria
-----------------
The search function supports four possible match criteria, which may be
supplied in any combination:
* maximum Levenshtein distance (``max_l_dist``)
* maximum # of subsitutions
* maximum # of deletions ("delete" = skip a character in the sub-sequence)
* maximum # of insertions ("insert" = skip a character in the sequence)
Not supplying a criterion means that there is no limit for it. For this reason,
one must always supply ``max_l_dist`` and/or all other criteria.
.. code:: python
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
# this will not match since max-deletions is set to zero
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1, max_deletions=0)
[]
# note that a deletion + insertion may be combined to match a substution
>>> find_near_matches('PATTERN', '---PAT-ERN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=1, matched="PAT-ERN")] # the Levenshtein distance is still 1
# ... but deletion + insertion may also match other, non-substitution differences
>>> find_near_matches('PATTERN', '---PATERRN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=2, matched="PATERRN")]
Owner
- Name: Tal Einat
- Login: taleinat
- Kind: user
- Repositories: 42
- Profile: https://github.com/taleinat
GitHub Events
Total
- Watch event: 21
- Push event: 1
- Create event: 1
Last Year
- Watch event: 21
- Push event: 1
- Create event: 1
Committers
Last synced: over 2 years ago
Top Committers
| Name | Commits | |
|---|---|---|
| Tal Einat | t****t@g****m | 277 |
| Tal Einat | t****t@s****m | 10 |
| Tal Einat | 5****t | 2 |
Committer Domains (Top 20 + Academic)
Issues and Pull Requests
Last synced: 7 months ago
All Time
- Total issues: 45
- Total pull requests: 2
- Average time to close issues: 4 months
- Average time to close pull requests: about 4 hours
- Total issue authors: 30
- Total pull request authors: 2
- Average comments per issue: 2.56
- Average comments per pull request: 2.0
- Merged pull requests: 0
- Bot issues: 0
- Bot pull requests: 0
Past Year
- Issues: 1
- Pull requests: 0
- Average time to close issues: N/A
- Average time to close pull requests: N/A
- Issue authors: 1
- Pull request authors: 0
- Average comments per issue: 0.0
- Average comments per pull request: 0
- Merged pull requests: 0
- Bot issues: 0
- Bot pull requests: 0
Top Authors
Issue Authors
- taleinat (5)
- kevinrue (3)
- DanielBiskup (3)
- sasi143 (3)
- georgh (3)
- prabhatM (2)
- spooknik (2)
- levitation (2)
- jtlz2 (1)
- Ericxgao (1)
- heshamwhite (1)
- sanjeevpe (1)
- yasinzaehringer-paradime (1)
- Stonatus (1)
- theo-allnutt-bioinformatics (1)
Pull Request Authors
- Aman-Clement (2)
- maximkir-fl (1)
Top Labels
Issue Labels
enhancement (5)
bug (4)
question (1)
wontfix (1)
Pull Request Labels
Packages
- Total packages: 2
-
Total downloads:
- pypi 277,596 last-month
- Total docker downloads: 3,022
-
Total dependent packages: 14
(may contain duplicates) -
Total dependent repositories: 274
(may contain duplicates) - Total versions: 18
- Total maintainers: 1
pypi.org: fuzzysearch
fuzzysearch is useful for finding approximate subsequence matches
- Homepage: https://github.com/taleinat/fuzzysearch
- Documentation: https://fuzzysearch.readthedocs.io/
- License: MIT
-
Latest release: 0.8.0
published 9 months ago
Rankings
Downloads: 0.9%
Dependent repos count: 0.9%
Dependent packages count: 1.1%
Docker downloads count: 1.6%
Average: 2.8%
Stargazers count: 3.9%
Forks count: 8.1%
Maintainers (1)
Last synced:
6 months ago
conda-forge.org: fuzzysearch
- Homepage: https://github.com/taleinat/fuzzysearch
- License: MIT
-
Latest release: 0.7.3
published over 4 years ago
Rankings
Stargazers count: 22.8%
Forks count: 33.2%
Dependent repos count: 34.0%
Average: 35.3%
Dependent packages count: 51.2%
Last synced:
6 months ago
Dependencies
requirements_dev.txt
pypi
- bump2version * development
- cython * development
- sphinx * development
- tox <3 development
- virtualenv * development
setup.py
pypi
- attrs >=19.3