Publication

• Song W, Steensen K, Thomas T. (2017) HgtSIM: a simulator for horizontal gene transfer (HGT) in microbial communities. PeerJ 5:e4015 https://doi.org/10.7717/peerj.4015 PDF
• Contact: Weizhi Song (songwz03@gmail.com), Torsten Thomas(t.thomas@unsw.edu.au)
• Affiliation: The Centre for Marine Bio-Innovation (CMB), The University of New South Wales, Sydney, Australia

Workflow

Dependencies

• BioPython
• BLAST+

Change Log

• 2019-01-06:

  • HgtSIM can be installed with "pip3 install HgtSIM" now.

• 2018-04-06:

  • combined the '-mixed', '-mini' and '-maxi' options into one: '-mixed min-max'.

• 2017-09-16:

  • add support for draft genome.
  • add support for dynamic flanking sequences.
  • add support for the 'mixed' mode.
  • add support for the 'keep_cds' option.

To-do

• run Prodigal if "-keep_cds" was specified
• check Ns in provided gene sequences
• check whether provided sequences to transfer are ORFs, exit if not

Installation

• HgtSIM is implemented in python3, you can install it with:

  pip3 install HgtSIM
  

• HgtSIM requires BLAST+, you can either add it to your system path or specify full path to "blastn" and "blastp" executables with options "-blastn" and "-blastp".

Help information

    HgtSIM -h

      -t          sequences of genes to be transferred (multi-fasta format)
      -i          mutation level
      -d          distribution of transfers to the recipient genomes
      -f          folder holds recipient genomes
      -r          ratio of mutation types
      -x          file extension of recipient genomes
      -lf         left end flanking sequences
      -rf         right end flanking sequences
      -mixed      randomly assign mutation levels between specified values, parameter format: min-max
      -keep_cds   insert transfers only to non-coding regions, need the annotation files (in gbk format) of recipient genomes
      -a          folder holds the annotation files (in gbk format) of recipient genomes
      -l          minimum length of intergenic region to be considered for insertion
      -blastn     path to blastn executable, default: blastn
      -blastp     path to blastp executable, default: blastp

Input files and arguments

1. Sequences of genes to be transferred (in multi-fasta format).
2. A folder holds all recipient genomes, one file per genome.

3. The mutation level of genes to be transferred. This can be specified either as a fixed value, or within a range (the 'mixed' mode). If the 'mixed' argument was provided, HgtSIM will randomly select a value between user specified minimum and maximum mutation levels to alter each gene transfer.

   # with fixed mutation level (e.g. 10%).
   HgtSIM -t genes.fasta -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna -i 10
   
   # with 'mixed' mode (e.g. 5-25%)
   HgtSIM -t genes.fasta -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna -mixed 5-25
   

4. The ratio of mutation categories (separated with dash). The default setting is '1-0-1-1'. Please refer to the publication (http://dx.doi.org/10.7717/peerj.4015) or the figure below for its setting.

   

5. The distribution of transfers to the recipient genomes. The first column refers to the recipient genomes(without file extension), followed by a list of genes to be transferred therein (separated with comma).

   BAD,AAM_03063,AKV_01007,AMAC_01196,AMAU_02632,AMS_01785
   BDS,AAM_00175,AKV_00943,AMAC_00215,AMAU_02085,AMS_01465
   BGC,AAM_00176,AKV_01272,AMAC_01576,AMAU_00617,AMS_02653
   BHS,AAM_00195,AKV_01273,AMAC_01674,AMAU_05963,AMS_03303
   BNM,AAM_00209,AKV_00282,AMAC_02914,AMAU_02414,AMS_03378
   BRT,AAM_00308,AKV_02353,AMAC_03303,AMAU_00830,AMS_01655
   

6. The flanking sequences to be added to the end of gene transfers. Can be specified with '-lf' and '-rf', the default value is None.

   # introduce gene transfers without adding flanking sequences
   HgtSIM -t genes.fasta -i 10 -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna
   
   # or, add same pair of flanking sequences (e.g. 'TAGATGAGTGATTAGTTAGTTA') to all gene transfers
   HgtSIM -t genes.fasta -i 10 -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna -lf TAGATGAGTGATTAGTTAGTTA -rf TAGATGAGTGATTAGTTAGTTA
   
   # or, add flanking sequences dynamically to the two ends of each gene transfer
   HgtSIM -t genes.fasta -i 10 -d distribution.txt -f input_genomes -r 1-0-1-1 -x fna -lf lf.fasta -rf rf.fasta
   

   if you want to add flanking sequences dynamically to the gene transfers, you can specify the left and right side sequences in two multi-fasta files. The IDs of the flanking sequences need to be exactly the same to their corresponding gene transfers.

   As an illustration, if you have four transfers, which are transferA, transferB, transferC and transferD. And you have provided the following two files:

   lf.fasta

   >transfer_A
   AAAAAAAAAA
   >transfer_B
   TTT
   

   rf.fasta

   >transfer_A
   GGGGGGG
   >transfer_C
   CCCCC
   

   HgtSIM will then:

   1. add 'AAAAAAAAAA' to the left and 'GGGGGGG' to the right end of transfer_A;
   2. add 'TTT' to the left and nothing to the right end of transfer_B;
   3. add nothing to the left and 'CCCCC' to the right end of transfer_C;
   4. add nothing to boths end of transfer_D.

7. Transfers can be inserted only to the intergenic regions by specifying the 'keep_cds' option. The annotation files (in genbank format) of the recipient genomes are needed to enable this option.

Output files

1. Produced genomes with transferred genes, which were placed in folder 'Genomeswithtransfers'.
2. The amino acid sequences of input genes to be transferred.
3. The nucleotide and amino acid sequences of mutated input genes.
4. The mutation report file, which includes two parts:
   1. on the top is the nc and aa identities between input and mutated sequences for each transfer.
   2. followed by a summary of changed nucleotide bases for each transfer.
5. The insertion report file.