Science Score: 39.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
○CITATION.cff file
-
✓codemeta.json file
Found codemeta.json file -
✓.zenodo.json file
Found .zenodo.json file -
✓DOI references
Found 2 DOI reference(s) in README -
○Academic publication links
-
○Committers with academic emails
-
○Institutional organization owner
-
○JOSS paper metadata
-
○Scientific vocabulary similarity
Low similarity (9.5%) to scientific vocabulary
Keywords
Repository
a DNA assembly library
Basic Info
- Host: GitHub
- Owner: Lattice-Automation
- License: mit
- Language: Python
- Default Branch: master
- Homepage: https://lattice-automation.github.io/synbio
- Size: 24.7 MB
Statistics
- Stars: 22
- Watchers: 7
- Forks: 2
- Open Issues: 5
- Releases: 0
Topics
Metadata Files
README.md
synbio
synbio is a library for designing and assembling DNA. Users can design plasmids or libraries and export multi-step build protocols. Input SeqRecords. Output assembly SeqRecords, protocols, plate maps, and robotic picklists.
Documentation is available at https://lattice-automation.github.io/synbio
Installation
bash
pip install synbio
Models
synbio only expects the user to define their Design and Protocol. Several protocols are pre-defined.
Designs
All are in synbio.designs:
Combinatorial- list of SeqRecords to combinatorially anneal into all valid assembliesCombinatorialBins- list of bins of SeqRecords for combinatorial assembly of records between binsPlasmid- single list of SeqRecords to combine into a plasmidPlasmidLibrary- list of list of SeqRecords to combine into plasmids
Protocols
All are in synbio.protocols:
Gibson- Gibson assembly based on NEB's E5510GoldenGate- Golden Gate assembly based on NEB's E1601
Example
In the example below, the user specifies a combinatorial library design. All SeqRecords are tested for circularization with other SeqRecords. New and valid plasmids are assembled.
Behind the scenes, synbio is filtering all combinations of SeqRecords from the design that will circularize into valid plasmids (via circuits in a graph). After running the protocol, users can export plate maps (to_csv()), composite plasmids (to_fasta(), to_genbank()), and assembly instructions (to_txt(), to_picklists()).
```python """Example of a Combinatorial Golden Gate assembly with human and robot output protocols."""
import os from Bio.SeqIO import parse from synbio.designs import Combinatorial from synbio.protocols import GoldenGate
def readallrecords(): ggdir = os.path.join(".", "data", "goldengate") records = [] for file in os.listdir(ggdir): if file.endswith(".gb"): records.extend(parse(os.path.join(gg_dir, file), "genbank")) return records
create a combinatorial library design from all valid combinations
design = Combinatorial(readallrecords())
create a protocol using Golden Gate as the sole composite step and run
protocol = GoldenGate( name="Combinatorial Golden Gate", design=design, include=["KanR"], # only keep circularized plasmids with a KanR SeqFeature mincount=5, # only keep circularized plasmids from >=5 SeqRecords ) protocol.tofasta("plasmids.fasta") # export multi-FASTA protocol.tocsv("plates.csv") # export plate layouts protocol.totxt("protocol.txt") # export human protocol protocol.to_picklists("picklist", platform="hamilton") # export a hamilton picklist ```
plasmids.fasta:
```txt
J23100AB+B0032mBC+C0012mCD+B0015DE+DVK_AE GGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGTCACACAGGAAAG TACTAAATGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT ... ```
plates.csv:
csv
Setup Wells with volumes (uL) shown:
Plate:1,1,2,3,4,5,6,7,8,9,10,11,12
A,B0015_DE(4),C0080_CD(18),R0010_AB(54),water(36)
B,B0015_DE(160),DVK_AE(160),cre_CD(18),water(156)
...
protocol.txt:
txt
Combinatorial GoldenGate:
1. Setup PCR plate with (volumes) shown:
1.1. Dilute plasmid DNA to 75 ng/µL in 'water'
1.2. Create 'assembly-mix' from 1:1 T4 Ligase Buffer (10X) and NEB Golden Gate Assembly Mix
...
picklist.gwl:
txt
A;Plate:2;;;15;;2.0;;;
D;Plate:3;;;80;;2.0;;;
W;;;;;;;;;
...
Annotation
In addition to DNA assembly, synbio exposes a plasmid annotation function in synbio.features. An example below shows a SeqRecord being augmented with additional SeqFeatures from a curated database of common plasmid features.
```python from Bio.SeqIO import parse from synbio.features import annotate
record = next(parse("plasmid.fa", "fasta")) recordwithfeatures = annotate(record, identity=0.96) ```
Alternatives
This is a non-exhaustive list. Contact me for a comparison of these libraries/platforms and synbio.
- Aquarium is an extensive library/application for LIMS, protocol definition/execution, and workflow design. A lab operating system.
- Autoprotocol is a specification standard for experiments in the life sciences.
- BioBricks is a general focus, web-based editor for describing experiments in Biology.
- Biocoder is a C++ library with extensive protocol step definition capabilities.
- Plateo is a python library for planning, running and checking laboratory experiments. Great for parsing and exporting plates and picklists form multiple formats.
- pydna is a python DNA assembly simulation library with a human-readable description of clone and assembly strategies.
Owner
- Name: Lattice Automation
- Login: Lattice-Automation
- Kind: organization
- Location: Boston, MA
- Website: https://latticeautomation.com/
- Repositories: 7
- Profile: https://github.com/Lattice-Automation
We make software solutions that enable synthetic biology workflows, pipelines, and best practices.
GitHub Events
Total
- Issues event: 1
- Watch event: 3
- Issue comment event: 1
- Member event: 2
- Push event: 1
- Pull request event: 1
- Pull request review event: 1
Last Year
- Issues event: 1
- Watch event: 3
- Issue comment event: 1
- Member event: 2
- Push event: 1
- Pull request event: 1
- Pull request review event: 1
Committers
Last synced: about 3 years ago
All Time
- Total Commits: 199
- Total Committers: 2
- Avg Commits per committer: 99.5
- Development Distribution Score (DDS): 0.005
Top Committers
| Name | Commits | |
|---|---|---|
| JJTimmons | j****1@g****m | 198 |
| leshane | l****k@g****m | 1 |
Issues and Pull Requests
Last synced: 9 months ago
All Time
- Total issues: 12
- Total pull requests: 4
- Average time to close issues: 13 days
- Average time to close pull requests: 7 days
- Total issue authors: 2
- Total pull request authors: 2
- Average comments per issue: 0.42
- Average comments per pull request: 2.75
- Merged pull requests: 3
- Bot issues: 0
- Bot pull requests: 0
Past Year
- Issues: 0
- Pull requests: 0
- Average time to close issues: N/A
- Average time to close pull requests: N/A
- Issue authors: 0
- Pull request authors: 0
- Average comments per issue: 0
- Average comments per pull request: 0
- Merged pull requests: 0
- Bot issues: 0
- Bot pull requests: 0
Top Authors
Issue Authors
- jjtimmons (11)
- guzmanvig (1)
- GabrielleJohnston (1)
Pull Request Authors
- digithed (4)
- jjtimmons (1)
Top Labels
Issue Labels
Pull Request Labels
Packages
- Total packages: 1
-
Total downloads:
- pypi 297 last-month
- Total dependent packages: 0
- Total dependent repositories: 1
- Total versions: 54
- Total maintainers: 2
pypi.org: synbio
Synbio design and build library
- Homepage: https://github.com/Lattice-Automation/synbio
- Documentation: https://synbio.readthedocs.io/
- License: GNU General Public License v2 (GPLv2)
-
Latest release: 0.6.18
published 10 months ago
Rankings
Dependencies
- biopython >=1.74.0
- fuzzywuzzy *
- networkx >=2.3.0
- primers >=0.2.4