Python pakcage for genomic variant analysis

How to install?

pip install variant

How to use?

🧬 variant motif subcommand can fetch motif sequence around given site.

``` Usage: variant motif [OPTIONS]

Fetch genomic motif.

╭─ Options ─────────────────────────────────────────────────────────────────╮ │ --input -i TEXT Input position file. │ │ --output -o TEXT Output annotation file. │ │ * --fasta -f TEXT reference fasta file. [required] │ │ --npad -n TEXT Number of padding base to call motif. If you │ │ want to set different left and right pads, │ │ use comma to separate them. (eg. 2,3) │ │ --padding -p TEXT Padding base to use for motif. 'N' by default │ │ but can be set to any single letter │ │ --with-header -H With header line in input file. │ │ --columns -c TEXT Sets columns for site info. │ │ (Chrom,Pos,Strand) │ │ [default: 1,2,3] │ │ --to-upper -u Convert motif to upper case. │ │ --wrap-site -w Wrap motif site. │ │ --help -h Show this message and exit. │ ╰───────────────────────────────────────────────────────────────────────────╯ ```

demo:

I would like to get the 2 bases before the given sites, and 3 bases after the given sites, meanwhile, wrap the give sites with bracket. Moreover, the strand information should be taken into account.

use -n 2,3 -w

🧫 variant effect subcommand can infer the effect of a mutation

``` Usage: variant effect [OPTIONS]

Annotation genomic variant effect.

╭─ Options ────────────────────────────────────────────────────────────────╮ │ --input -i TEXT Input position file. │ │ --output -o TEXT Output annotation file │ │ --reference -r TEXT reference species │ │ --reference-gtf TEXT Customized reference gtf file. │ │ --reference-transcript TEXT Customized reference transcript │ │ fasta file. │ │ --reference-protein TEXT Customized reference protein fasta │ │ file. │ │ --release -e INTEGER ensembl release │ │ --strandness -s Use strand infomation or not? │ │ --pU-mode -u Make rRNA, tRNA, snoRNA into top │ │ priority. │ │ --npad -n INTEGER Number of padding base to call │ │ motif. │ │ --all-effects -a Output all effects. │ │ --with-header -H With header line in input file. │ │ --columns -c TEXT Sets columns for site info. │ │ (Chrom,Pos,Strand,Ref,Alt) │ │ [default: 1,2,3,4,5] │ │ --help -h Show this message and exit. │ ╰──────────────────────────────────────────────────────────────────────────╯ ```

demo:

Store the following table in file (sites.tsv).

| Chrom | Position | Strand | Ref | Alt | | ----- | --------- | ------ | --- | --- | | chr1 | 230703034 | - | C | T | | chr12 | 69353439 | + | A | T | | chr14 | 23645352 | + | G | T | | chr2 | 215361150 | - | A | T | | chr2 | 84906537 | + | C | T | | chr22 | 39319077 | - | T | A | | chr22 | 39319095 | - | T | A | | chr22 | 39319098 | - | T | A |

Run command:

bash variant-effect -i sites.tsv -H -r human -e 108 -t RNA -H -c 1,2,3

• -i specify the input file
• -H means the file is with header line, and the first row will be skipped;
• -r use the specific genome, default is human
• -e specify the Ensembl release version
• -c means only use some of the columns in the input file. default will use the first 5 columns.

You will have this output

| Chrom | Position | Strand | Ref | Alt | muttype | genetype | genename | genepos | transcriptname | transcriptpos | transcriptmotif | codingpos | codonref | aapos | aaref | distance2splice | | :---- | :-------- | :----- | :-- | :-- | :------------ | :------------- | :---------------------- | :------- | :-------------------------- | :------------- | :-------------------- | :--------- | :-------- | :----- | :----- | --------------- | | chr1 | 230703034 | - | C | T | ThreePrimeUTR | proteincoding | ENSG00000135744(AGT) | 42543 | ENST00000680041(AGT-208) | 1753 | TGTGTCACCCCCAGTCTCCCA | None | None | None | None | 295 | | chr12 | 69353439 | + | A | T | ThreePrimeUTR | proteincoding | ENSG00000090382(LYZ) | 5059 | ENST00000261267(LYZ-201) | 695 | TAGAACTAATACTGGTGAAAA | None | None | None | None | 286 | | chr14 | 23645352 | + | G | T | ThreePrimeUTR | proteincoding | ENSG00000100867(DHRS2) | 15238 | ENST00000344777(DHRS2-202) | 1391 | CTGCCATTCTGCCAGACTAGC | None | None | None | None | 210 | | chr2 | 215361150 | - | A | T | ThreePrimeUTR | proteincoding | ENSG00000115414(FN1) | 74924 | ENST00000323926(FN1-201) | 8012 | GGCCCGCAATACTGTAGGAAC | None | None | None | None | 476 | | chr2 | 84906537 | + | C | T | ThreePrimeUTR | proteincoding | ENSG00000034510(TMSB10) | 882 | ENST00000233143(TMSB10-201) | 327 | CCTGGGCACTCCGCGCCGATG | None | None | None | None | 148 | | chr22 | 39319077 | - | T | A | Intronic | proteincoding | ENSG00000100316(RPL3) | 1313 | ENST00000216146(RPL3-201) | None | None | None | None | None | None | None | | chr22 | 39319095 | - | T | A | Intronic | proteincoding | ENSG00000100316(RPL3) | 1295 | ENST00000216146(RPL3-201) | None | None | None | None | None | None | None | | chr22 | 39319098 | - | T | A | Intronic | protein_coding | ENSG00000100316(RPL3) | 1292 | ENST00000216146(RPL3-201) | None | None | None | None | None | None | None |

🧫 variant coordinate subcommand can mapping chrom name and positions between different reference coordinate

``` Usage: variant coordinate [OPTIONS]

Fetch genomic motif.

╭─ Options ───────────────────────────────────────────────────────────────────╮ │ --input -i TEXT Input position file. │ │ --output -o TEXT Output annotation file. │ │ --reference-mapping -m TEXT Mapping file for chrom name, first column is │ │ chrom in the input, second column is chrom │ │ in the reference db (sep by tab) │ │ --buildin-mapping -M TEXT Build-in mapping for chrom name: U2E (UCSC │ │ to Ensembl), E2U (Ensembl to UCSC) │ │ --with-header -H With header line in input file. │ │ --columns -c TEXT Sets columns for site info. (Chrom) │ │ [default: 1] │ │ --help -h Show this message and exit. │ ╰─────────────────────────────────────────────────────────────────────────────╯

```

⏳⏳⏳ more functions will be supported in the future

TODO:

• imporve speed. Base on cgranges, pyranges?, or BioCantor?