https://github.com/huttleylab/phylim
Python project to validate a phylogenetic fitted models is within the limits of inference
Science Score: 49.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
○CITATION.cff file
-
✓codemeta.json file
Found codemeta.json file -
✓.zenodo.json file
Found .zenodo.json file -
✓DOI references
Found 3 DOI reference(s) in README -
✓Academic publication links
Links to: zenodo.org -
○Academic email domains
-
○Institutional organization owner
-
○JOSS paper metadata
-
○Scientific vocabulary similarity
Low similarity (16.5%) to scientific vocabulary
Keywords
Repository
Python project to validate a phylogenetic fitted models is within the limits of inference
Basic Info
Statistics
- Stars: 8
- Watchers: 1
- Forks: 2
- Open Issues: 2
- Releases: 9
Topics
Metadata Files
README.md
phylim: a phylogenetic limit evaluation library built on cogent3
phylim evaluates the identifiability when estimating the phylogenetic tree using the Markov model. The identifiability is the key condition of the Markov model used in phylogenetics to fulfil consistency.
Establishing identifiability relies on the arrangement of specific types of transition probability matrices (e.g., DLC and sympathetic) while avoiding other types. A key concern arises when a tree does not meet the condition that, for each node, a path to a tip must exist where all matrices along the path are DLC. Such trees are not identifiable 🪚🎄! For instance, in the figure below, tree T' contains a node surrounded by a specific type of non-DLC matrix, rendering it non-identifiable. In contrast, compare T' with tree T.
phylim provides a quick, handy method to check the identifiability of a model fit, where we developed a main cogent3 app, phylim. phylim is compatible with piqtree, a python library that exposes features from iqtree2.
The following content will demonstrate how to set up phylim and give some tutorials on the main identifiability check app and other associated apps.
Installation
pip install phylim
Let's see if it has been done successfully. In the package directory:
pytest
Hope all tests passed! :whitecheckmark: :blush:
Run the check of identifiability
If you fit a model to an alignment and get the model result:
```python
from cogent3 import getapp, makealigned_seqs
aln = makealignedseqs( ... { ... "Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG", ... "Gorilla": "ATGCGGCGCGCGGAGGCCGCGCTCGCGGAG", ... "Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG", ... }, ... info={"moltype": "dna", "source": "foo"}, ... )
appfit = getapp("model", "GTR") result = app_fit(aln) ```
You can easily check the identifiability by:
```python
checker = get_app("phylim")
checked = checker(result) checked.is_identifiable
True ```
The phylim app wraps all information about phylogenetic limits.
```python
checked ```
| Source | Model Name | Identifiable | Has Boundary Values | Version |
|---|---|---|---|---|
| brca1.fasta | GTR | True | True | 2025.1.12 |
You can also use features like classifying all matrices or checking boundary values in a model fit.
Label all transition probability matrices in a model fit
You can call `classify_model_psubs` to give the category of all the matrices: ```python >>> from phylim import classify_model_psubs >>> labelled = classify_model_psubs(result) >>> labelled ```| edge name | matrix category |
|---|---|
| Gorilla | DLC |
| Human | DLC |
| Mouse | DLC |
Check if all parameter fits are within the boundary
```python >>> from phylim import check_fit_boundary >>> violations = check_fit_boundary(result) >>> violations BoundsViolation(source='foo', vio=[{'par_name': 'C/T', 'init': np.float64(1.0000000147345554e-06), 'lower': 1e-06, 'upper': 50}, {'par_name': 'A/T', 'init': np.float64(1.0000000625906854e-06), 'lower': 1e-06, 'upper': 50}]) ```❗For users who want to check identifiability on a model with multiple likelihood functions (e.g. split codon model), please check https://github.com/HuttleyLab/PhyLim/issues/23#issuecomment-3125670158
Check identifiability for piqtree
phylim provides an app, phylim_to_model_result, which allows you to build the likelihood function from a piqtree output tree.
```python
phylo = getapp("piqbuild_tree", model="GTR") tree = phylo(aln)
lffrom = getapp("phylimtomodelresult") result = lffrom(tree)
checker = getapp("phylim") checked = checker(result) checked.isidentifiable
True ```
Colour the edges for a phylogenetic tree based on matrix categories
If you obtain a model fit, phylim can visualise the tree with labelled matrices.
phylim provides an app, phylim_style_tree, which takes an edge-matrix category map and colours the edges:
```python
from phylim import classifymodelpsubs
edgetocat = classifymodelpsubs(result) tree = result.tree
treestyler = getapp("phylimstyletree", edgetocat) tree_styler(tree) ```
You can also colour edges using a user-defined edge-matrix category map, applicable to any tree object!
```python
from cogent3 import make_tree from phylim import SYMPATHETIC, DLC
tree = maketree("(A, B, C);") edgeto_cat = {"A":SYMPATHETIC, "B":SYMPATHETIC, "C":DLC}
treestyler = getapp("phylimstyletree", edgetocat) tree_styler(tree) ```
Owner
- Name: HuttleyLab
- Login: HuttleyLab
- Kind: organization
- Repositories: 4
- Profile: https://github.com/HuttleyLab
GitHub Events
Total
- Create event: 9
- Issues event: 4
- Release event: 8
- Watch event: 8
- Issue comment event: 7
- Public event: 1
- Push event: 20
- Pull request review event: 2
- Pull request event: 32
- Fork event: 2
Last Year
- Create event: 9
- Issues event: 4
- Release event: 8
- Watch event: 8
- Issue comment event: 7
- Public event: 1
- Push event: 20
- Pull request review event: 2
- Pull request event: 32
- Fork event: 2
Issues and Pull Requests
Last synced: 9 months ago
All Time
- Total issues: 3
- Total pull requests: 12
- Average time to close issues: about 1 month
- Average time to close pull requests: about 1 hour
- Total issue authors: 2
- Total pull request authors: 3
- Average comments per issue: 1.67
- Average comments per pull request: 0.08
- Merged pull requests: 8
- Bot issues: 0
- Bot pull requests: 2
Past Year
- Issues: 3
- Pull requests: 12
- Average time to close issues: about 1 month
- Average time to close pull requests: about 1 hour
- Issue authors: 2
- Pull request authors: 3
- Average comments per issue: 1.67
- Average comments per pull request: 0.08
- Merged pull requests: 8
- Bot issues: 0
- Bot pull requests: 2
Top Authors
Issue Authors
- GavinHuttley (2)
- YapengLang (1)
Pull Request Authors
- YapengLang (15)
- dependabot[bot] (2)
- GavinHuttley (2)
Top Labels
Issue Labels
Pull Request Labels
Packages
- Total packages: 1
-
Total downloads:
- pypi 133 last-month
- Total dependent packages: 0
- Total dependent repositories: 0
- Total versions: 9
- Total maintainers: 2
pypi.org: phylim
A library for checking the limits of phylogenetic tree estimation.
- Documentation: https://phylim.readthedocs.io/
- License: BSD License
-
Latest release: 2025.8.27
published 9 months ago