grepq

grepq: A Rust application that quickly filters FASTQ files by matching sequences to a set of regular expressions - Published in JOSS (2025)

https://github.com/rbfinch/grepq

Science Score: 98.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
    Found CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
    Found 12 DOI reference(s) in README and JOSS metadata
  • Academic publication links
    Links to: joss.theoj.org
  • Academic email domains
  • Institutional organization owner
  • JOSS paper metadata
    Published in Journal of Open Source Software

Keywords

bioinformatics fastq grep grep-like grep-search grepping gzip json regex sqlite zstd
Last synced: 7 months ago · JSON representation ·

Repository

quickly filter fastq files by matching sequences to a set of regex patterns

Basic Info
Statistics
  • Stars: 54
  • Watchers: 1
  • Forks: 1
  • Open Issues: 2
  • Releases: 55
Topics
bioinformatics fastq grep grep-like grep-search grepping gzip json regex sqlite zstd
Created over 1 year ago · Last pushed 9 months ago
Metadata Files
Readme Changelog Contributing License Citation Codemeta

README.md

Quickly filter FASTQ files

Crates.io Crates.io Total Downloads License DOI

Table of Contents

Feature set

[!NOTE] This README contains documentation for the latest version of grepq. If you are working through this documentation and the examples, please ensure that you are using the latest version. You can check the version by running grepq -V. For installation instructions, see the Installation section.

  • very fast and scales to large FASTQ files
  • IUPAC ambiguity code support
  • support for gzip and zstd compression
  • JSON support for pattern file input and tune and summarise command output, allowing named regex sets, named regex patterns, and named and unnamed variants
  • use predicates to filter on the header field (= record ID line) using a regex, minimum sequence length, and minimum average quality score (supports Phred+33 and Phred+64)
  • does not match false positives
  • output matched sequences to one of four formats
  • optionally output matched sequences to a SQLite database file, including GC content, tetranucleotide and canonical tetranucleotide frequencies, and regex pattern matches and their position(s) in each matched FASTQ sequence, allowing for further analysis
  • tune your pattern file and enumerate named and unnamed variants with the tune command (use the summarise command to process all FASTQ records)
  • bucket matching sequences to separate files named after each regexName with the --bucket flag, in any of the four output formats
  • supports inverted matching with the inverted command
  • plays nicely with your unix workflows
  • comprehensive help, examples and testing script
  • read the JOSS paper

Features and performance in detail

1. Very fast and scales to large FASTQ files

| tool | mean wall time (s) | S.D. wall time (s) | speedup (× grep) | speedup (× ripgrep) | speedup (× awk) | |---------------|--------------------|--------------------|------------------|---------------------|-----------------| | grepq | 0.19 | 0.01 | 1796.76 | 18.62 | 863.52 | | fqgrep | 0.34 | 0.01 | 1017.61 | 10.55 | 489.07 | | ripgrep | 3.57 | 0.01 | 96.49 | 1.00 | 46.37 | | seqkit grep | 2.89 | 0.01 | 119.33 | 1.24 | 57.35 | | grep | 344.26 | 0.55 | 1.00 | 0.01 | 0.48 | | awk | 165.45 | 1.59 | 2.08 | 0.02 | 1.00 | | gawk | 287.66 | 1.68 | 1.20 | 0.01 | 0.58 |

Details

2022 model Mac Studio with 32GB RAM and Apple M1 max chip running macOS 15.0.1. The FASTQ file (SRX26365298.fastq) was 874MB in size and was stored on the internal SSD (APPLE SSD AP0512R). The pattern file contained 30 regex patterns (see `examples/16S-no-iupac.txt` for the patterns used). grepq v1.4.0, fqgrep v.1.02, ripgrep v14.1.1, seqkit grep v.2.9.0, grep 2.6.0-FreeBSD, awk v. 20200816, and gawk v.5.3.1. fqgrep and seqkit grep were run with default settings, ripgrep was run with -B 1 -A 2 --colors 'match:none' --no-line-number, and grep -B 1 -A 2 was run with --color=never. The tools were configured to output matching records in FASTQ format. The wall times, given in seconds, are the mean of 10 runs, and S.D. is the standard deviation of the wall times, also given in seconds.

2. Reads and writes regular or gzip or zstd-compressed FASTQ files

Use the --best option for best compression, or the --fast option for faster compression.

| tool | mean wall time (s) | S.D. wall time (s) | speedup (× ripgrep) | |-----------|--------------------|--------------------|---------------------| | grepq | 1.71 | 0.00 | 2.10 | | fqgrep | 1.83 | 0.01 | 1.95 | | ripgrep | 3.58 | 0.01 | 1.00 |

Details

Conditions and versions as above, but the FASTQ file was gzip-compressed. `grepq` was run with the `--read-gzip` option, `ripgrep` with the `-z` option, and `grep` with the `-Z` option. The wall times, given in seconds, are the mean of 10 runs, and S.D. is the standard deviation of the wall times, also given in seconds.

3. Predicates

Predicates can be used to filter on the header field (= record ID line) using a regex, minimum sequence length, and minimum average quality score (supports Phred+33 and Phred+64).

[!NOTE] A regex supplied to filter on the header field (= record ID line) is first passed as a string to the regex engine, and then the regex engine is used to match the header field. Regex patterns to match the header field (= record ID line) must comply with the Rust regex library syntax (https://docs.rs/regex/latest/regex/#syntax). If you get an error message, be sure to escape any special characters in the regex pattern.

Predicates are specified in a JSON pattern file. For an example, see 16S-iupac-and-predicates.json in the examples directory.

4. Does not match false positives

grepq will only match regex patterns to the sequence of a FASTQ record, which is the most common use case. Unlike ripgrep and grep, which will match the regex patterns to the entire FASTQ record, which includes the record ID, sequence, separator, and quality fields. This can lead to false positives and slow down the filtering process. When multiple regex patterns are provided, a matched sequence is one where any of the regex patterns in the pattern file match the sequence of the FASTQ record.

5. Output matched sequences to one of four formats

  • sequences only (default)
  • sequences and their corresponding record IDs (-I option)
  • FASTA format (-F option)
  • FASTQ format (-R option)

[!NOTE] Other than when the tune or summarise command is run (see below), a FASTQ record is deemed to match (and hence provided in the output) when any of the regex patterns in the pattern file match the sequence of the FASTQ record.

6. Optionally output matched sequences to a SQLite database file

Other than when the inverted command is given, output to a SQLite database is supported with the writeSQL option. The SQLite database will contain a table called fastq_data with the following fields: the fastq record (header, sequence and quality fields), length of the sequence (length), percent GC content (GC), percent GC content as an integer (GCint), number of unique tetranucleotides in the sequence (nTN), number of unique canonical tetranucleotides in the sequence (nCTN), percent tetranucleotide frequency in the sequence (TNF), percent canonical tetranucleotide frequency in the sequence (CTNF), and a JSON array containing the matched regex patterns, the matches and their position(s) in the FASTQ sequence (variants). If the pattern file was given in JSON format and contained a non-null qualityEncoding field, then the average quality score for the sequence (averagequality) will also be written. The --num-tetranucleotides option can be used to limit the number of tetranucleotides written to the TNF and CTNF fields of the fastq_data SQLite table, these being the most or equal most frequent tetranucleotides and canonical tetranucleotides in the sequence of the matched FASTQ records. A summary of the invoked query (pattern and data files) is written to a second table called query.

The structure of the fastq_data table facilitates database indexing and provides a rich dataset to further query. Since all elements of each matched FASTQ record are also written, a FASTQ file can be reconstructed from the SQLite database (see examples/export_fastq.sql for an example of how to do this; and scripts examples/summarise.sql and examples/variants-as-json-array.sql could also come in handy).

7. Tune your pattern file and enumerate named and unnamed variants with the tune command

Use the tune or summarise command (grepq tune -h and grepq summarise -h for instructions) in a simple shell script to update the number and order of regex patterns in your pattern file according to their matched frequency, further targeting and speeding up the filtering process.

Specifying the -c option to the tuneor summarise command will output the matched substrings and their frequencies, ranked from highest to lowest.

When the patterns file is given in JSON format, then specifying the -c, --names, --json-matches and --variants options to the tune or summarise command will output the matched pattern variants and their corresponding counts in JSON format to a file called matches.json, allowing named regex sets, named regex patterns, and named and unnamed variants. See examples/16S-iupac.json for an example of a JSON pattern file and examples/matches.json for an example of the output of the tune or summarise command in JSON format.

```bash

For each matched pattern in a search of no more than 20000 matches of a gzip-compressed FASTQ file, print the pattern and the number of matches to a JSON file called matches.json, and include the top three most frequent variants of each pattern, and their respective counts

grepq --read-gzip 16S-no-iupac.json SRX26365298.fastq.gz tune -n 20000 -c --names --json-matches --variants 3 ```

Abridged output (see examples/matches.json for the full output):

json { "regexSet": { "regex": [ { "regexCount": 2, "regexName": "Primer contig 06a", "regexString": "[AG]AAT[AT]G[AG]CGGGG", "variants": [ { "count": 1, "variant": "GAATTGGCGGGG", "variantName": "06a-v3" }, { "count": 1, "variant": "GAATTGACGGGG", "variantName": "06a-v1" } ] }, // matches for other regular expressions... ], "regexSetName": "conserved 16S rRNA regions" } }

To output all variants of each pattern, use the --all argument, for example:

```bash

For each matched pattern in a search of no more than 20000 matches of a gzip-compressed FASTQ file, print the pattern and the number of matches to a JSON file called matches.json, and include all variants of each pattern, and their respective counts. Note that the --variants argument is not given when --all is specified.

grepq --read-gzip 16S-no-iupac.json SRX26365298.fastq.gz tune -n 20000 -c --names --json-matches --all ```

You could then use a tool like jq to parse the JSON output of the tune or summarise command, for example the following command will sort the output by the number of matches for each regex pattern, and then for each pattern, sort the variants by the number of matches:

bash jq -r ' .regexSet.regex | sort_by(-.regexCount)[] | "\(.regexName): \(.regexCount)\n" + ( .variants | sort_by(-.count)[] | " \(.variantName // "unnamed"): \(.variant): \(.count)" ) ' matches.json

[!NOTE] When the count option (-c) is given with the tune or summarise command, grepq will count the number of FASTQ records containing a sequence that is matched, for each matching regex in the pattern file. If, however, there are multiple occurrences of a given regex within a FASTQ record sequence field, grepq will count this as one match. To ensure all records are processed, use the summarise command instead of the tune command. When the count option (-c) is not given as part of the tune or summarise command, grepq provides the total number of matching FASTQ records for the set of regex patterns in the pattern file. Further, note that counts produced through independently matching regex patterns to the sequence of a FASTQ record inherently underestimate the true number of those patterns in the biological sample, since a regex pattern may span two reads (i.e., be truncated at either the beginning or end of a read). To illustrate, a regex pattern representing a 12-mer motif has a 5.5% chance of being truncated for a read length of 400 nucleotides (11/400 + 11/400 = 22/400 = 0.055 or 5.5%), assuming a uniform distribution of motif positions and reads are sampled randomly with respect to motifs (this calculation would need to be adjusted to the extent that motifs are not uniformly distributed and reads are not randomly sampled with respect to motifs).

8. Supports inverted matching with the inverted command

Use the inverted command to output sequences that do not match any of the regex patterns in your pattern file.

9. Plays nicely with your unix workflows

For example, see tune.sh in the examples directory. This simple script will filter a FASTQ file using grepq, tune the pattern file on a user-specified number of total matches, and then filter the FASTQ file again using the tuned pattern file for a user-specified number of the most frequent regex pattern matches.

Usage

Get instructions and examples using grepq -h, or grepq tune -h, grepq summarise -h and grepq inverted -h for more information on the tune, summarise and inverted commands, respectively. See the examples directory for examples of pattern files and FASTQ files, and the cookbook.sh and cookbook.md files for more examples. Finally, help.md contains a full dump of the help output, in markdown format.

[!NOTE] grepq can output to several formats, including those that are gzip or zstd compressed. grepq, however, will only accept a FASTQ file or a compressed (gzip or zstd) FASTQ file as the sequence data file. If you get an error message, check that the input data file is a FASTQ file or a gzip or zstd compressed FASTQ file, and that you have specified the correct file format (--read-gzip or --read-zstd for FASTQ files compressed by gzip and zstd, respectively), and file path. Pattern files must contain one regex pattern per line or be provided in JSON format, and patterns are case-sensitive. You can supply an empty pattern file to count the total number of records in the FASTQ file. The regex patterns for matching FASTQ sequences should only include the DNA sequence characters (A, C, G, T), or IUPAC ambiguity codes (N, R, Y, etc.). See 16S-no-iupac.txt, 16S-iupac.json, 16S-no-iupac.json, and 16S-iupac-and-predicates.json in the examples directory for examples of valid pattern files. Regex patterns to match the header field (= record ID line) must comply with the Rust regex library syntax (https://docs.rs/regex/latest/regex/#syntax). If you get an error message, be sure to escape any special characters in the regex pattern.

Preparing pattern files

Whilst grepq can accept pattern files in plain text format (one regex pattern per line), it is recommended to use JSON format for more complex pattern files since JSON pattern files can contain named regex sets, named regex patterns, and named and unnamed variants. JSON can be a little verbose, so you may want to prepare you pattern file in YAML format (for example, see 16S-iupac.yaml in the examples directory) and then convert it to JSON using a tool like yq. For example, to convert a YAML pattern file to JSON, use the following command:

bash yq eval '. | tojson' pattern-file.yaml > pattern-file.json

grepq will validate the JSON pattern file before processing it, and will provide an error message if the JSON pattern file is not valid. However, if you wish to validate the JSON pattern file before running grepq, you can use a tool such as ajv and grepq's JSON schema file (grepq-schema.json, located in the examples directory), for example:

bash ajv --strict=false -s grepq-schema.json -d pattern-file.json

Requirements

  • grepq has been tested on Linux (x86-64 and ARM64) and macOS (ARM64). It might work on other platforms, but it has not been tested.
  • Ensure that Rust is installed on your system (https://www.rust-lang.org/tools/install)
  • Ensure that the dependencies are installed on your system. If you are using a package manager, you can install them with the following commands:
    • For Ubuntu/Debian: sudo apt update && sudo apt install -y build-essential cmake libsqlite3-dev libzstd-dev sqlite3
    • For macOS: brew install sqlite zstd
  • If you are installing from bioconda, you will need to have conda or miniconda installed on your system. You can install conda or miniconda from https://docs.conda.io/en/latest/miniconda.html or https://docs.conda.io/projects/conda/en/latest/user-guide/install/index.html.
  • If the build fails, make sure you have the latest version of the Rust compiler by running rustup update
  • To run the test.sh and cookbook.sh scripts in the examples directory, you will need yq (v4.44.6 or later), gunzip and version 4 or later of bash.

Installation

First, install the dependencies described in the Requirements section, see above. Then, you can install grepq in one of the following ways:

  • From crates.io (easiest method, but will not install the examples directory)

    • cargo install grepq
  • From source (will install the examples directory)

    • Clone the repository and cd into the grepq directory
    • Run cargo build --release
    • Relative to the cloned parent directory, the executable will be located in ./target/release
    • Make sure the executable is in your PATH or use the full path to the executable
  • From bioconda (assumes conda or miniconda is installed; will not install the examples directory)

    • conda init fish # Or conda init bash, or conda init zsh
    • conda create -n myenv # Create a new environment named "myenv"
    • conda activate myenv # Activate the new environment
    • conda config --add channels conda-forge # Add conda-forge channel
    • conda config --prepend channels bioconda # Add bioconda channel with higher priority
    • conda config --set channel_priority strict # Set strict channel priority
    • conda install grepq # Install grepq

Examples and tests

Get instructions and examples using grepq -h, or grepq tune -h, grepq summarise -h and grepq inverted -h for more information on the tune, summarise and inverted commands, respectively. See the examples directory for examples of pattern files and FASTQ files, and the cookbook.sh and cookbook.md files for more examples.

File sizes of outfiles to verify grepq is working correctly, using the regex file 16S-no-iupac.txt and the small fastq file small.fastq, both located in the examples directory:

```bash grepq ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt 15953

grepq ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt 736547

grepq -I ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt 19515

grepq -I ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt 901271

grepq -R ./examples/16S-no-iupac.txt ./examples/small.fastq > outfile.txt 35574

grepq -R ./examples/16S-no-iupac.txt ./examples/small.fastq inverted > outfile.txt 1642712 ```

For the curious-minded, note that the regex patterns in 16S-no-iupac.txt, 16S-iupac.json, 16S-no-iupac.json, and 16S-iupac-and-predicates.json are from Table 3 of Martinez-Porchas, Marcel, et al. "How conserved are the conserved 16S-rRNA regions?." PeerJ 5 (2017): e3036.

For more examples, see the examples directory and the cookbook, available also as a shell script in the examples directory.

Test script

To run the test script, you must have yq (v4.44.6 or later), gunzip and version 4 or later of bash installed on your system. Then follow all steps to install grepq from source (refer instructions in the Installation section), cd into the examples directory and run the following command:

bash ./test.sh commands-1.yaml; ./test.sh commands-2.yaml; ./test.sh commands-3.yaml; ./test.sh commands-4.yaml

If all tests pass, there will be no orange (warning) text in the output, and no test will report a failure. A summary of the number of passing and failing tests will be displayed at the end of the output. All tests should pass.

Example of failing test output:

test-7 failed
expected: 54 counts
got: 53 counts
command was: ../target/release/grepq -c 16S-no-iupac.txt small.fastq

Further, you can run the cookbook.sh script in the examples directory to test the cookbook examples, and you can use predate (https://crates.io/crates/predate) if you prefer a Rust application to a shell script.

```bash

SARS-CoV-2 example

Count of the top five most frequently matched patterns found in SRX26602697.fastq using the pattern file SARS-CoV-2.txt (this pattern file contains 64 sequences of length 60 from Table II of this preprint):

```bash time grepq SARS-CoV-2.txt SRX26602697.fastq tune -n 10000 -c | head -5 GTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGT: 1595 CGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGA: 693 TCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAA: 356 GCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCT: 332 CCGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTAT: 209


Executed in 218.80 millis fish external usr time 188.97 millis 0.09 millis 188.88 millis sys time 31.47 millis 4.98 millis 26.49 millis

```

Obtain SRX26602697.fastq from the SRA using fastq-dump --accession SRX26602697.

Further testing

grepq can be tested using tools that generate synthetic FASTQ files, such as spikeq (https://crates.io/crates/spikeq)

You can verify that grepq has found the regex patterns by using tools such as grep and ripgrep, using their ability to color-match the regex patterns (this feature is not available in grepq as that would make the code more complicated; code maintainability is an objective of this project). Recall, however, that grep and ripgrep will match the regex patterns to the entire FASTQ record, which includes the record ID, sequence, separator, and quality fields, occasionally leading to false positives.

Citation

If you use grepq in your research, please cite as follows:

Crosbie, N. D., (2025). grepq: A Rust application that quickly filters FASTQ files by matching sequences to a set of regular expressions. Journal of Open Source Software, 10(110), 8048, https://doi.org/10.21105/joss.08048

@article{Crosbie2025, doi = {10.21105/joss.08048}, url = {https://doi.org/10.21105/joss.08048}, year = {2025}, publisher = {The Open Journal}, volume = {10}, number = {110}, pages = {8048}, author = {Nicholas D. Crosbie}, title = {grepq: A Rust application that quickly filters FASTQ files by matching sequences to a set of regular expressions}, journal = {Journal of Open Source Software} }}

Update changes

see CHANGELOG

Contributing and issue reporting

see CONTRIBUTING

License

MIT

Owner

  • Login: Rbfinch
  • Kind: user

JOSS Publication

grepq: A Rust application that quickly filters FASTQ files by matching sequences to a set of regular expressions
Published
June 30, 2025
Volume 10, Issue 110, Page 8048
Authors
Nicholas D. Crosbie ORCID
Melbourne Veterinary School, University of Melbourne, Parkville, Victoria, Australia
Editor
Lorena Pantano ORCID
Tags
FASTQ records regular expressions bioinformatics variants

Citation (CITATION.cff)

cff-version: "1.2.0"
authors:
- email: nicholas.crosbie@unimelb.edu.au
  family-names: Crosbie
  given-names: Nicholas D.
  orcid: "https://orcid.org/0000-0002-0319-4248"
contact:
- email: nicholas.crosbie@unimelb.edu.au
  family-names: Crosbie
  given-names: Nicholas D.
  orcid: "https://orcid.org/0000-0002-0319-4248"
doi: 10.5281/zenodo.15612061
message: If you use this software, please cite our article in the
  Journal of Open Source Software.
preferred-citation:
  authors:
  - email: nicholas.crosbie@unimelb.edu.au
    family-names: Crosbie
    given-names: Nicholas D.
    orcid: "https://orcid.org/0000-0002-0319-4248"
  date-published: 2025-06-30
  doi: 10.21105/joss.08048
  issn: 2475-9066
  issue: 110
  journal: Journal of Open Source Software
  publisher:
    name: Open Journals
  start: 8048
  title: "grepq: A Rust application that quickly filters FASTQ files by
    matching sequences to a set of regular expressions"
  type: article
  url: "https://joss.theoj.org/papers/10.21105/joss.08048"
  volume: 10
title: "grepq: A Rust application that quickly filters FASTQ files by
  matching sequences to a set of regular expressions"

CodeMeta (codemeta.json)

{
  "@context": "https://raw.githubusercontent.com/codemeta/codemeta/master/codemeta.jsonld",
  "@type": "Code",
  "author": [
    {
      "@id": "https://orcid.org/0000-0002-0319-4248",
      "@type": "Person",
      "email": "",
      "name": "Nicholas D. Crosbie",
      "affiliation": "University of Melbourne"
    }
  ],
  "identifier": "https://zenodo.org/records/14649271",
  "codeRepository": "https://github.com/Rbfinch/grepq",
  "datePublished": "2025-01-17",
  "dateModified": "2025-01-17",
  "dateCreated": "2025-01-17",
  "description": "Quickly filter FASTQ files",
  "keywords": "bioinformatics, FASTQ, REGEX, JSON, CLI",
  "license": "MIT",
  "title": "grepq",
  "version": "v1.4.1"
}

GitHub Events

Total
  • Create event: 60
  • Issues event: 10
  • Release event: 51
  • Watch event: 52
  • Delete event: 4
  • Issue comment event: 4
  • Public event: 1
  • Push event: 373
  • Pull request event: 3
Last Year
  • Create event: 60
  • Issues event: 10
  • Release event: 51
  • Watch event: 52
  • Delete event: 4
  • Issue comment event: 4
  • Public event: 1
  • Push event: 373
  • Pull request event: 3

Issues and Pull Requests

Last synced: 7 months ago

All Time
  • Total issues: 4
  • Total pull requests: 2
  • Average time to close issues: 28 days
  • Average time to close pull requests: about 19 hours
  • Total issue authors: 4
  • Total pull request authors: 2
  • Average comments per issue: 0.5
  • Average comments per pull request: 0.0
  • Merged pull requests: 2
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 4
  • Pull requests: 2
  • Average time to close issues: 28 days
  • Average time to close pull requests: about 19 hours
  • Issue authors: 4
  • Pull request authors: 2
  • Average comments per issue: 0.5
  • Average comments per pull request: 0.0
  • Merged pull requests: 2
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • BiotechPedro (1)
  • johanneskoester (1)
  • nh13 (1)
  • shenwei356 (1)
  • PawelWojciechowski (1)
Pull Request Authors
  • Rbfinch (1)
Top Labels
Issue Labels
enhancement (1)
Pull Request Labels

Packages

  • Total packages: 1
  • Total downloads:
    • cargo 46,737 total
  • Total dependent packages: 0
  • Total dependent repositories: 0
  • Total versions: 65
  • Total maintainers: 1
crates.io: grepq

quickly filter fastq files

  • Versions: 65
  • Dependent Packages: 0
  • Dependent Repositories: 0
  • Downloads: 46,737 Total
Rankings
Dependent repos count: 24.7%
Dependent packages count: 32.8%
Average: 51.2%
Downloads: 96.1%
Maintainers (1)
Last synced: 7 months ago