https://github.com/akikuno/dajin2

🔬 Genotyping tool for genome-edited samples using nanopore-targeted sequencing

https://github.com/akikuno/dajin2

Science Score: 49.0%

This score indicates how likely this project is to be science-related based on various indicators:

  • CITATION.cff file
  • codemeta.json file
    Found codemeta.json file
  • .zenodo.json file
    Found .zenodo.json file
  • DOI references
    Found 4 DOI reference(s) in README
  • Academic publication links
    Links to: plos.org, zenodo.org
  • Committers with academic emails
  • Institutional organization owner
  • JOSS paper metadata
  • Scientific vocabulary similarity
    Low similarity (16.0%) to scientific vocabulary

Keywords

bioconda bioinformatics crispr-target genome-analysis genomics long-read-sequencing nanopore python3
Last synced: 10 months ago · JSON representation

Repository

🔬 Genotyping tool for genome-edited samples using nanopore-targeted sequencing

Basic Info
  • Host: GitHub
  • Owner: akikuno
  • License: mit
  • Language: Python
  • Default Branch: main
  • Homepage:
  • Size: 561 MB
Statistics
  • Stars: 14
  • Watchers: 2
  • Forks: 0
  • Open Issues: 13
  • Releases: 26
Topics
bioconda bioinformatics crispr-target genome-analysis genomics long-read-sequencing nanopore python3
Created almost 5 years ago · Last pushed 11 months ago
Metadata Files
Readme Contributing License Code of conduct

README.md

License Test Python PyPI Bioconda DOI Paper Contact

README

DAJIN2 is a genotyping tool for genome-edited samples, utilizing nanopore target sequencing.

DAJIN2 takes its name from the Japanese phrase **** (Ichimou DAJIN, or Ywng Djn in Chinese),
which means to capture everything in a single sweep.
This reflects the tools design philosophy: to comprehensively detect both intended and unintended genome editing outcomes in one go.

Features

  • Comprehensive Mutation Detection
    DAJIN2 can detect a wide range of genome editing events in nanopore-targeted regions, from point mutations to structural variants.
    It is particularly effective at identifying unexpected mutations and complex mutations, such as insertions within deleted regions.

  • Highly Sensitive Allele Classification
    Supports classification of mosaic alleles, capable of detecting minor alleles present at approximately 1%.

  • Intuitive Visualization
    Genome editing results are visualized in an intuitive manner, enabling rapid and easy identification of mutations.

  • Multi-Sample Support
    Batch processing of multiple samples is supported, allowing efficient execution of large-scale experiments and comparative studies.

  • Simple Installation and Operation
    Requires no specialized computing environment and runs smoothly on a standard laptop.
    Easily installable via Bioconda or PyPI, and usable via the command line.

Installation

System Requirements

Hardware

  • Runs on a standard laptop
  • Recommended memory: 8 GB or more

[!NOTE] DAJIN2 is the successor to DAJIN, which required a GPU for efficient computation due to its use of deep learning.
In contrast, DAJIN2 does not use deep learning and does not require a GPU.
Therefore, it runs smoothly on typical laptops.

Software

  • Python 3.9-3.12
  • Unix-based environment (Linux, macOS, WSL2, etc.)

[!IMPORTANT] For Windows Users
DAJIN2 is designed to run in a Linux environment.
If you are using Windows, please use WSL2 (Windows Subsystem for Linux 2).

From Bioconda (Recommended)

```bash

Setting up Bioconda

conda config --add channels defaults conda config --add channels bioconda conda config --add channels conda-forge conda config --set channel_priority flexible

Install DAJIN2

conda create -n env-dajin2 python=3.12 DAJIN2 -y conda activate env-dajin2 ```

From PyPI

bash pip install DAJIN2

[!IMPORTANT] DAJIN2 is actively being developed and improved.
Please make sure you are using the latest version to take advantage of the newest features.

To check your current version: bash DAJIN2 --version

Check the latest version:
https://github.com/akikuno/DAJIN2/releases

To update to the latest version: bash conda update DAJIN2 -y or bash pip install -U DAJIN2

[!CAUTION] If you encounter any issues during the installation, please refer to the Troubleshooting Guide

Usage

Required Files

FASTQ/FASTA/BAM Files for Sample and Control

In DAJIN2, a control that has not undergone genome editing is necessary to detect genome-editing-specific mutations. Specify a directory containing the FASTQ/FASTA (both gzip compressed and uncompressed) or BAM files of the genome editing sample and control.

Basecalling with Guppy

After basecalling with Guppy, the following file structure will be output:

text fastq_pass barcode01 fastq_runid_b347657c88dced2d15bf90ee6a1112a3ae91c1af_0_0.fastq.gz fastq_runid_b347657c88dced2d15bf90ee6a1112a3ae91c1af_10_0.fastq.gz fastq_runid_b347657c88dced2d15bf90ee6a1112a3ae91c1af_11_0.fastq.gz barcode02 fastq_runid_b347657c88dced2d15bf90ee6a1112a3ae91c1af_0_0.fastq.gz fastq_runid_b347657c88dced2d15bf90ee6a1112a3ae91c1af_10_0.fastq.gz fastq_runid_b347657c88dced2d15bf90ee6a1112a3ae91c1af_11_0.fastq.gz

Assuming barcode01 is the control and barcode02 is the sample, the respective directories are specified as follows:

  • Control: fastq_pass/barcode01
  • Sample: fastq_pass/barcode02

Basecalling with Dorado

For basecalling with Dorado (dorado demux), the following file structure will be output:

text dorado_demultiplex EXP-PBC096_barcode01.bam EXP-PBC096_barcode02.bam

[!IMPORTANT] Store each BAM file in a separate directory. The directory names can be set arbitrarily.

text dorado_demultiplex barcode01 EXP-PBC096_barcode01.bam barcode02 EXP-PBC096_barcode02.bam

Similarly, store the FASTA files outputted after sequence error correction with dorado correct in separate directories.

text dorado_correct barcode01 EXP-PBC096_barcode01.fasta barcode02 EXP-PBC096_barcode02.fasta

Assuming barcode01 is the control and barcode02 is the sample, the respective directories are specified as follows:

  • Control: dorado_demultiplex/barcode01 / dorado_correct/barcode01
  • Sample: dorado_demultiplex/barcode02 / dorado_correct/barcode02

FASTA File Including Anticipated Allele Sequences

The FASTA file should contain descriptions of the alleles anticipated as a result of genome editing.

[!IMPORTANT] A header name >control and its sequence are necessary.

If there are anticipated alleles (e.g., knock-ins or knock-outs), include their sequences in the FASTA file too. These anticipated alleles can be named arbitrarily.

Below is an example of a FASTA file:

```text

control ACGTACGTACGTACGT knock-in ACGTACGTCCCCACGTACGT knock-out ACGTACGT ```

Here, >control represents the sequence of the control allele, while >knock-in and >knock-out represent the sequences of the anticipated knock-in and knock-out alleles, respectively.

[!IMPORTANT] Ensure that both ends of the FASTA sequence match those of the amplicon sequence. If the FASTA sequence is longer or shorter than the amplicon, the difference may be recognized as an indel.

Single Sample Analysis

DAJIN2 allows for the analysis of single samples (one sample vs one control).

```bash DAJIN2 <-s|--sample> <-c|--control> <-a|--allele> <-n|--name> \ [-g|--genome] [-b|--bed] [-t|--threads] [--no-filter] [-h|--help] [-v|--version]

Options: -s, --sample Specify the path to the directory containing sample FASTQ/FASTA/BAM files. -c, --control Specify the path to the directory containing control FASTQ/FASTA/BAM files. -a, --allele Specify the path to the FASTA file. -n, --name (Optional) Set the output directory name. Default: 'Results'. -g, --genome (Optional) Specify the reference UCSC genome ID (e.g., hg38, mm39). Default: '' (empty string). -b, --bed (Optional) Specify the path to BED6 file containing genomic coordinates. Default: '' (empty string). -t, --threads (Optional) Set the number of threads. Default: 1. --no-filter (Optional) Disable minor allele filtering (keep alleles <0.5%). Default: False. -h, --help Display this help message and exit. -v, --version Display the version number and exit. ```

Using BED Files for Genomic Coordinates

If the reference genome is not from UCSC, or if the external servers that DAJIN2 depends on (UCSC Genome Browser and GGGENOME) are unavailable, you can specify a BED file using the -b/--bed option to run offline.

When using the -b/--bed option with a BED file, please ensure:

  1. Use BED6 format (6 columns required): chr1 1000000 1001000 mm39 248956422 +

Column descriptions: - Column 1: Chromosome name (e.g., chr1, chr2) - Column 2: Start position (0-based, inclusive) - Column 3: End position (0-based, exclusive) - Column 4: Name (genome ID) - Column 5: Score (chromosome size for proper IGV visualization) - Column 6: Strand (+ or -, must match FASTA allele orientation)

[!NOTE]
For the score field (column 5), please enter the size of the chromosome specified in column 1.
While the original BED format limits scores to 1000, DAJIN2 accepts chromosome sizes without any issue.

[!IMPORTANT]
Strand orientation must match. The strand field (column 6: + or -) in your BED file must match the strand orientation of your FASTA allele sequences.
- If your FASTA allele sequence is on the forward strand (5' to 3'), use + in the BED file
- If your FASTA allele sequence is on the reverse strand (3' to 5'), use - in the BED file

For detailed BED file usage, see BEDCOORDINATEUSAGE.md.

Rare Mutation Detection with --no-filter

By default, DAJIN2 filters out alleles with read counts below 0.5% (5 reads out of 100,000 downsampled reads) to reduce noise and improve accuracy. However, when analyzing rare mutations or somatic mosaicism where minor alleles may be present at very low frequencies, you can use the --no-filter option to disable this filtering.

When to use --no-filter: - Detecting rare somatic mutations (< 0.5% frequency) - Analyzing samples with suspected low-level mosaicism - Research requiring detection of all possible alleles regardless of frequency

Usage: bash DAJIN2 \ --control example_single/control \ --sample example_single/sample \ --allele example_single/stx2_deletion.fa \ --name stx2_deletion \ --genome mm39 \ --threads 4 \ --no-filter

[!CAUTION] Using --no-filter may increase noise and false positives in the results. It is recommended to validate rare alleles through additional experimental methods.

Example

```bash

Download example dataset

curl -LJO https://github.com/akikuno/DAJIN2/raw/main/examples/examplesingle.tar.gz tar -xf examplesingle.tar.gz

Run DAJIN2

DAJIN2 \ --control examplesingle/control \ --sample examplesingle/sample \ --allele examplesingle/stx2deletion.fa \ --name stx2_deletion \ --genome mm39 \ --threads 4 ```

Batch Processing

By using the batch subcommand, you can process multiple samples simultaneously.
For this purpose, a CSV or Excel file consolidating the sample information is required.

[!NOTE] For guidance on how to compile sample information, please refer to this document.

Required columns: sample, control, allele, name
Optional columns: genome, bed (or genome_coordinate), and any custom columns

Example CSV with BED files: csv sample,control,allele,name,bed /path/to/sample1,/path/to/control1,/path/to/allele1.fa,experiment1,/path/to/coords1.bed /path/to/sample2,/path/to/control2,/path/to/allele2.fa,experiment2,/path/to/coords2.bed

[!TIP] It is recommended to use the same value in the name column for samples that belong to the same experiment.
Using identical names enables parallel processing, thereby improving efficiency.
Here's an example batch.csv

```bash DAJIN2 batch <-f|--file> [-t|--threads] [--no-filter] [-h]

options: -f, --file Specify the path to the CSV or Excel file. -t, --threads (Optional) Set the number of threads. Default: 1. --no-filter (Optional) Disable minor allele filtering (keep alleles <0.5%). Default: False. -h, --help Display this help message and exit. ```

Example

```bash

Donwload the example dataset

curl -LJO https://github.com/akikuno/DAJIN2/raw/main/examples/examplebatch.tar.gz tar -xf examplebatch.tar.gz

Run DAJIN2

DAJIN2 batch --file example_batch/batch.csv --threads 4 ```

GUI (Graphical User Interface) Mode

DAJIN2 provides a web interface that can be launched with a single command:

bash DAJIN2 gui

When executed, your default web browser will open and display the following GUI at http://localhost:{PORT}/.

[!NOTE] If the browser does not launch automatically, please open your browser manually and navigate to http://localhost:{PORT}/.

Single Sample Analysis via GUI

  1. Launch GUI
    Run DAJIN2 gui to open the web interface.

  2. Project Setup

    • Project Name: Enter any analysis name
    • Directory Upload: Select directories containing sample or control FASTQ/FASTA/BAM files
    • Allele FASTA: Upload FASTA file containing expected allele sequences
    • BED File (optional): Upload BED6 format file to specify genomic coordinates
  3. Parameter Configuration

    • Reference Genome (optional): Specify UCSC genome ID (e.g., hg38, mm39)
    • Threads: Set the number of CPU threads to use
    • No Filter: Enable to detect rare mutations below 0.5% frequency
  4. Run Analysis
    Click "Start Analysis" and the progress will be displayed in real-time.

  5. View Results
    After completion, the output folder path will be displayed for accessing result files.

Batch Processing via GUI

  1. Prepare Batch File
    Create a CSV or Excel file with columns: sample, control, allele, name.

  2. Upload Batch File
    Use the "Batch Processing" tab to upload your configuration file.

  3. Configure Global Settings
    Set threads and filtering options for all samples at once.

  4. Monitor Progress
    The analysis status for each sample is displayed with detailed log output.

  5. View Results
    Results are saved in the DAJIN_Results/ folder with subdirectories for each sample.

Reports

Upon completion of DAJIN2 processing, a directory named DAJIN_Results/{NAME} is generated.
Inside the DAJIN_Results/{NAME} directory, the following files can be found:

DAJIN_Results/tyr-substitution BAM tyr_c230gt_01 tyr_c230gt_10 tyr_c230gt_50 tyr_control FASTA tyr_c230gt_01 tyr_c230gt_10 tyr_c230gt_50 HTML tyr_c230gt_01 tyr_c230gt_10 tyr_c230gt_50 MUTATION_INFO tyr_c230gt_01.csv tyr_c230gt_10.csv tyr_c230gt_50.csv read_plot.html read_plot.pdf read_summary.xlsx

1. BAM

The BAM directory contains the BAM files of reads classified by allele.

[!NOTE] Specifying a reference genome using the genome option will align the reads to that genome.
Without genome options, the reads will align to the control allele within the input FASTA file.

2. FASTA and HTML

The FASTA directory stores the FASTA files of each allele.
The HTML directory contains HTML files for each allele, where mutation sites are color-highlighted.
For example, Tyr point mutation is highlighted in green.

Furthermore, DAJIN2 extracts representative SV alleles (Insertion, Deletion, Inversion) included in the sample and highlights SV regions with colored underlines.
The following is an example where a deletion (light blue) and an insertion (red) are observed at both ends of an inversion (purple underline):

3. MUTATION_INFO

The MUTATION_INFO directory saves tables depicting mutation sites for each allele.
An example of a Tyr point mutation is described by its position on the chromosome and the type of mutation.

4. readsummary.xlsx, readplot.html and read_plot.pdf

readsummary.xlsx summarizes the number and proportion of reads per allele.
Both read
plot.html and read_plot.pdf illustrate the proportions of each allele.
The chart's Allele type indicates the type of allele, and Percent of reads shows the proportion of reads for each allele.

The Allele type includes: - Intact: Alleles that perfectly match the input FASTA allele. - Indels: Substitutions, deletions, insertions, or inversions within 50 bases. - SV: Substitutions, deletions, insertions, or inversions beyond 50 bases.

[!WARNING] In PCR amplicon sequencing, the % of reads might not match the actual allele proportions due to amplification bias.
Especially when large deletions are present, the deletion alleles might be significantly amplified, potentially not reflecting the actual allele proportions.

Feedback and Support

We welcome your questions, bug reports, and feedback.
Please use the following Google Form to submit your report:
Google Form

If you have a GitHub account, you can also submit reports via
GitHub Issues

Please refer to CONTRIBUTING for how to contribute and how to verify your contributions.

[!NOTE] For frequently asked questions, please refer to this page.

Code of Conduct

Please note that this project is released with a Contributor Code of Conduct.
By participating in this project you agree to abide by its terms.

References

For more information, please refer to the following publication:

Kuno A, et al. (2022) DAJIN enables multiplex genotyping to simultaneously validate intended and unintended target genome editing outcomes. PLoS Biology 20(1): e3001507.

Owner

  • Name: Akihiro Kuno
  • Login: akikuno
  • Kind: user
  • Location: Tsukuba, Ibaraki, Japan
  • Company: University of Tsukuba

Bioinformatician working at the Laboratory Animal Resource Center

GitHub Events

Total
  • Create event: 15
  • Release event: 4
  • Issues event: 61
  • Watch event: 5
  • Delete event: 10
  • Issue comment event: 31
  • Push event: 158
  • Pull request review event: 3
  • Pull request review comment event: 3
  • Pull request event: 21
Last Year
  • Create event: 15
  • Release event: 4
  • Issues event: 61
  • Watch event: 5
  • Delete event: 10
  • Issue comment event: 31
  • Push event: 158
  • Pull request review event: 3
  • Pull request review comment event: 3
  • Pull request event: 21

Committers

Last synced: over 2 years ago

All Time
  • Total Commits: 974
  • Total Committers: 3
  • Avg Commits per committer: 324.667
  • Development Distribution Score (DDS): 0.026
Past Year
  • Commits: 412
  • Committers: 3
  • Avg Commits per committer: 137.333
  • Development Distribution Score (DDS): 0.061
Top Committers
Name Email Commits
Akihiro Kuno a****o 949
akikuno a****o@g****m 13
Akihiro Kuno a****o@g****m 12
Committer Domains (Top 20 + Academic)

Issues and Pull Requests

Last synced: 10 months ago

All Time
  • Total issues: 65
  • Total pull requests: 61
  • Average time to close issues: 22 days
  • Average time to close pull requests: about 1 hour
  • Total issue authors: 4
  • Total pull request authors: 1
  • Average comments per issue: 0.77
  • Average comments per pull request: 0.0
  • Merged pull requests: 52
  • Bot issues: 0
  • Bot pull requests: 0
Past Year
  • Issues: 41
  • Pull requests: 21
  • Average time to close issues: 14 days
  • Average time to close pull requests: about 3 hours
  • Issue authors: 2
  • Pull request authors: 1
  • Average comments per issue: 0.44
  • Average comments per pull request: 0.0
  • Merged pull requests: 15
  • Bot issues: 0
  • Bot pull requests: 0
Top Authors
Issue Authors
  • akikuno (60)
  • zpashkutz (2)
  • takeiga (2)
  • chengarthur (1)
Pull Request Authors
  • akikuno (61)
Top Labels
Issue Labels
request (20) bug🐛 (15) solved (13) request💡 (13) bug (8) maintenance (7) on-going (4) maintenance✨️ (3) documentation📝 (3) enhancement (2)
Pull Request Labels

Packages

  • Total packages: 1
  • Total downloads:
    • pypi 71 last-month
  • Total dependent packages: 0
  • Total dependent repositories: 0
  • Total versions: 60
  • Total maintainers: 1
pypi.org: dajin2

Comprehensive genotyping tool for targeted long-read sequencing analysis

  • Versions: 60
  • Dependent Packages: 0
  • Dependent Repositories: 0
  • Downloads: 71 Last month
Rankings
Dependent packages count: 6.6%
Downloads: 15.8%
Average: 21.8%
Stargazers count: 25.5%
Forks count: 30.5%
Dependent repos count: 30.6%
Maintainers (1)
Last synced: 10 months ago

Dependencies

.github/workflows/pytest.yml actions
  • actions/checkout v3 composite
  • actions/setup-python v4 composite
requirements.txt pypi
  • Flask >=2.2.0
  • Jinja2 >=3.1.0
  • cstag >=0.3.0
  • kaleido >=0.2.0
  • mappy >=2.0.0
  • midsv >=0.7.1
  • numpy >=1.20.0
  • openpyxl >=3.0.0
  • pandas >=1.0.0
  • plotly >=5.0.0
  • pysam >=0.19.0
  • scikit-learn >=1.0.0
  • scipy >=1.6.0
  • waitress >=2.1.0
  • wslPath >=0.3.0