nf-crispr-primer-design
Nextflow pipeline for primer design for sequencing CRISPR target sites
https://github.com/pfizer-opensource/nf-crispr-primer-design
Science Score: 57.0%
This score indicates how likely this project is to be science-related based on various indicators:
-
✓CITATION.cff file
Found CITATION.cff file -
✓codemeta.json file
Found codemeta.json file -
✓.zenodo.json file
Found .zenodo.json file -
✓DOI references
Found 4 DOI reference(s) in README -
○Academic publication links
-
○Academic email domains
-
○Institutional organization owner
-
○JOSS paper metadata
-
○Scientific vocabulary similarity
Low similarity (14.9%) to scientific vocabulary
Repository
Nextflow pipeline for primer design for sequencing CRISPR target sites
Basic Info
- Host: GitHub
- Owner: pfizer-opensource
- License: apache-2.0
- Language: Python
- Default Branch: main
- Size: 94.7 KB
Statistics
- Stars: 0
- Watchers: 1
- Forks: 0
- Open Issues: 0
- Releases: 0
Metadata Files
README.md
pfizer-opensource/nf-crispr-primer-design
Introduction
pfizer-opensource/nf-crispr-primer-design is a bioinformatics pipeline that designs primers
for sequencing CRISPR-edited target sites. The pipeline takes CRISPR guide sequences as
input, finds their location in a reference genome, and then designs primers to amplify
the edited region. In addition to outputing target-specific primers, the pipeline can
also generate primers with NGS adapter sequences added on. This pipeline is a companion
to the pfizer-opensource/nf-gene-editing-ngs pipeline, and produces an amplicons.yaml file
that is compatible with that gene editing NGS analysis pipeline.
Usage
[!NOTE] If you are new to Nextflow and nf-core, please refer to this page on how to set-up Nextflow.
The only required input file is a tab-delimited text file with guide identifiers and guide sequences. The input data should look like this:
guides.txt:
tsv
guide_id guide_seq
HPRT-ctrl AATTATGGGGATTACTAGGA
Each row represents a CRISPR guide, and a primer pair will be designed for that guide.
You will also need to tell the pipeline which reference genome to use for the primer design and a prefix string to use for naming the output files.
Now, you can run the pipeline using:
bash
nextflow run pfizer-opensource/nf-crispr-primer-design \
-profile <docker/singularity/.../institute> \
--input guides.txt \
--genome GRCh38 \
--prefix my_guides \
--outdir <OUTDIR>
[!WARNING] Please provide pipeline parameters via the CLI or Nextflow
-params-fileoption. Custom config files including those provided by the-cNextflow option can be used to provide any configuration except for parameters; see docs.
Credits
pfizer-opensource/nf-crispr-primer-design was originally written by Jason Arroyo.
Contributions and Support
If you would like to contribute to this pipeline, please see the contributing guidelines.
Citations
An extensive list of references for the tools used by the pipeline can be found in the CITATIONS.md file.
This pipeline uses code and infrastructure developed and maintained by the nf-core community, reused here under the MIT license.
The nf-core framework for community-curated bioinformatics pipelines.
Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.
Nat Biotechnol. 2020 Feb 13. doi: 10.1038/s41587-020-0439-x.
Owner
- Name: Pfizer Open Source
- Login: pfizer-opensource
- Kind: organization
- Repositories: 3
- Profile: https://github.com/pfizer-opensource
Citation (CITATIONS.md)
# pfizer-opensource/nf-crispr-primer-design: Citations ## [nf-core](https://pubmed.ncbi.nlm.nih.gov/32055031/) > Ewels PA, Peltzer A, Fillinger S, Patel H, Alneberg J, Wilm A, Garcia MU, Di Tommaso P, Nahnsen S. The nf-core framework for community-curated bioinformatics pipelines. Nat Biotechnol. 2020 Mar;38(3):276-278. doi: 10.1038/s41587-020-0439-x. PubMed PMID: 32055031. ## [Nextflow](https://pubmed.ncbi.nlm.nih.gov/28398311/) > Di Tommaso P, Chatzou M, Floden EW, Barja PP, Palumbo E, Notredame C. Nextflow enables reproducible computational workflows. Nat Biotechnol. 2017 Apr 11;35(4):316-319. doi: 10.1038/nbt.3820. PubMed PMID: 28398311. ## Pipeline tools ## Software packaging/containerisation tools - [Anaconda](https://anaconda.com) > Anaconda Software Distribution. Computer software. Vers. 2-2.4.0. Anaconda, Nov. 2016. Web. - [Bioconda](https://pubmed.ncbi.nlm.nih.gov/29967506/) > Grüning B, Dale R, Sjödin A, Chapman BA, Rowe J, Tomkins-Tinch CH, Valieris R, Köster J; Bioconda Team. Bioconda: sustainable and comprehensive software distribution for the life sciences. Nat Methods. 2018 Jul;15(7):475-476. doi: 10.1038/s41592-018-0046-7. PubMed PMID: 29967506. - [BioContainers](https://pubmed.ncbi.nlm.nih.gov/28379341/) > da Veiga Leprevost F, Grüning B, Aflitos SA, Röst HL, Uszkoreit J, Barsnes H, Vaudel M, Moreno P, Gatto L, Weber J, Bai M, Jimenez RC, Sachsenberg T, Pfeuffer J, Alvarez RV, Griss J, Nesvizhskii AI, Perez-Riverol Y. BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics. 2017 Aug 15;33(16):2580-2582. doi: 10.1093/bioinformatics/btx192. PubMed PMID: 28379341; PubMed Central PMCID: PMC5870671. - [Docker](https://dl.acm.org/doi/10.5555/2600239.2600241) > Merkel, D. (2014). Docker: lightweight linux containers for consistent development and deployment. Linux Journal, 2014(239), 2. doi: 10.5555/2600239.2600241. - [Singularity](https://pubmed.ncbi.nlm.nih.gov/28494014/) > Kurtzer GM, Sochat V, Bauer MW. Singularity: Scientific containers for mobility of compute. PLoS One. 2017 May 11;12(5):e0177459. doi: 10.1371/journal.pone.0177459. eCollection 2017. PubMed PMID: 28494014; PubMed Central PMCID: PMC5426675.
GitHub Events
Total
- Issues event: 1
- Watch event: 1
- Push event: 1
- Create event: 1
Last Year
- Issues event: 1
- Watch event: 1
- Push event: 1
- Create event: 1
Dependencies
- alpine 3.15 build
- build-base latest build
- confuse >=1.7.0,<2
- primer3-py >=0.6.1,<1
- pyyaml >=5.1.2
- confuse <2,>=1.7.0
- primer3-py >=0.6.1
- pyyaml >=5.1.2